ID: 1055353981

View in Genome Browser
Species Human (GRCh38)
Location 9:75418349-75418371
Sequence CACTAGGACTGGAGGACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055353972_1055353981 23 Left 1055353972 9:75418303-75418325 CCGGCACTAGGACTGGAGGACTG No data
Right 1055353981 9:75418349-75418371 CACTAGGACTGGAGGACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055353981 Original CRISPR CACTAGGACTGGAGGACTGT GGG Intergenic
No off target data available for this crispr