ID: 1055355372

View in Genome Browser
Species Human (GRCh38)
Location 9:75431984-75432006
Sequence GAGTCCACTCCAGATCTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055355372_1055355379 8 Left 1055355372 9:75431984-75432006 CCATGGAGATCTGGAGTGGACTC No data
Right 1055355379 9:75432015-75432037 CTTGGATGGGCCGCAAGCCTGGG No data
1055355372_1055355376 -6 Left 1055355372 9:75431984-75432006 CCATGGAGATCTGGAGTGGACTC No data
Right 1055355376 9:75432001-75432023 GGACTCTGTAGGGACTTGGATGG No data
1055355372_1055355377 -5 Left 1055355372 9:75431984-75432006 CCATGGAGATCTGGAGTGGACTC No data
Right 1055355377 9:75432002-75432024 GACTCTGTAGGGACTTGGATGGG No data
1055355372_1055355378 7 Left 1055355372 9:75431984-75432006 CCATGGAGATCTGGAGTGGACTC No data
Right 1055355378 9:75432014-75432036 ACTTGGATGGGCCGCAAGCCTGG No data
1055355372_1055355375 -10 Left 1055355372 9:75431984-75432006 CCATGGAGATCTGGAGTGGACTC No data
Right 1055355375 9:75431997-75432019 GAGTGGACTCTGTAGGGACTTGG No data
1055355372_1055355382 20 Left 1055355372 9:75431984-75432006 CCATGGAGATCTGGAGTGGACTC No data
Right 1055355382 9:75432027-75432049 GCAAGCCTGGGTGATGATGGAGG No data
1055355372_1055355380 17 Left 1055355372 9:75431984-75432006 CCATGGAGATCTGGAGTGGACTC No data
Right 1055355380 9:75432024-75432046 GCCGCAAGCCTGGGTGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055355372 Original CRISPR GAGTCCACTCCAGATCTCCA TGG (reversed) Intergenic
No off target data available for this crispr