ID: 1055355377

View in Genome Browser
Species Human (GRCh38)
Location 9:75432002-75432024
Sequence GACTCTGTAGGGACTTGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055355372_1055355377 -5 Left 1055355372 9:75431984-75432006 CCATGGAGATCTGGAGTGGACTC No data
Right 1055355377 9:75432002-75432024 GACTCTGTAGGGACTTGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055355377 Original CRISPR GACTCTGTAGGGACTTGGAT GGG Intergenic
No off target data available for this crispr