ID: 1055357791

View in Genome Browser
Species Human (GRCh38)
Location 9:75455263-75455285
Sequence CCATGGGAGGCCCTGTTATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055357785_1055357791 29 Left 1055357785 9:75455211-75455233 CCATCTAAGTTTTTGAATATAAT No data
Right 1055357791 9:75455263-75455285 CCATGGGAGGCCCTGTTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055357791 Original CRISPR CCATGGGAGGCCCTGTTATG AGG Intergenic
No off target data available for this crispr