ID: 1055365171

View in Genome Browser
Species Human (GRCh38)
Location 9:75536211-75536233
Sequence CAAATTATAAGATGTGTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055365171_1055365173 20 Left 1055365171 9:75536211-75536233 CCCTTTACACATCTTATAATTTG No data
Right 1055365173 9:75536254-75536276 AGCTTCATCTACTAATGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055365171 Original CRISPR CAAATTATAAGATGTGTAAA GGG (reversed) Intergenic
No off target data available for this crispr