ID: 1055365173

View in Genome Browser
Species Human (GRCh38)
Location 9:75536254-75536276
Sequence AGCTTCATCTACTAATGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055365171_1055365173 20 Left 1055365171 9:75536211-75536233 CCCTTTACACATCTTATAATTTG No data
Right 1055365173 9:75536254-75536276 AGCTTCATCTACTAATGAGCAGG No data
1055365170_1055365173 25 Left 1055365170 9:75536206-75536228 CCTTTCCCTTTACACATCTTATA No data
Right 1055365173 9:75536254-75536276 AGCTTCATCTACTAATGAGCAGG No data
1055365172_1055365173 19 Left 1055365172 9:75536212-75536234 CCTTTACACATCTTATAATTTGA No data
Right 1055365173 9:75536254-75536276 AGCTTCATCTACTAATGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055365173 Original CRISPR AGCTTCATCTACTAATGAGC AGG Intergenic
No off target data available for this crispr