ID: 1055366557

View in Genome Browser
Species Human (GRCh38)
Location 9:75550460-75550482
Sequence GTGGCAGGGCAGATCTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055366557_1055366565 25 Left 1055366557 9:75550460-75550482 CCTCCACAGATCTGCCCTGCCAC No data
Right 1055366565 9:75550508-75550530 ATTTTCTGGCTCTTTGCCTACGG No data
1055366557_1055366564 11 Left 1055366557 9:75550460-75550482 CCTCCACAGATCTGCCCTGCCAC No data
Right 1055366564 9:75550494-75550516 GTGATTTTGAACTAATTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055366557 Original CRISPR GTGGCAGGGCAGATCTGTGG AGG (reversed) Intergenic
No off target data available for this crispr