ID: 1055367751

View in Genome Browser
Species Human (GRCh38)
Location 9:75563257-75563279
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39248
Summary {0: 7, 1: 549, 2: 15445, 3: 11951, 4: 11296}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055367751 Original CRISPR ATGCTCAGTAATGGGATGGC TGG Intergenic
Too many off-targets to display for this crispr