ID: 1055372614

View in Genome Browser
Species Human (GRCh38)
Location 9:75616559-75616581
Sequence CCATCTTCCCATGTATCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055372614_1055372617 2 Left 1055372614 9:75616559-75616581 CCAGCAGATACATGGGAAGATGG No data
Right 1055372617 9:75616584-75616606 AGATAGAGGAAGTAGAGATTTGG No data
1055372614_1055372618 3 Left 1055372614 9:75616559-75616581 CCAGCAGATACATGGGAAGATGG No data
Right 1055372618 9:75616585-75616607 GATAGAGGAAGTAGAGATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055372614 Original CRISPR CCATCTTCCCATGTATCTGC TGG (reversed) Intergenic
No off target data available for this crispr