ID: 1055373267

View in Genome Browser
Species Human (GRCh38)
Location 9:75623745-75623767
Sequence TGGGCTCCTCTCCCACTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055373262_1055373267 -1 Left 1055373262 9:75623723-75623745 CCCTCTCAATGCTCTGAAAGTGT No data
Right 1055373267 9:75623745-75623767 TGGGCTCCTCTCCCACTTGAGGG No data
1055373261_1055373267 6 Left 1055373261 9:75623716-75623738 CCATGCTCCCTCTCAATGCTCTG No data
Right 1055373267 9:75623745-75623767 TGGGCTCCTCTCCCACTTGAGGG No data
1055373263_1055373267 -2 Left 1055373263 9:75623724-75623746 CCTCTCAATGCTCTGAAAGTGTG No data
Right 1055373267 9:75623745-75623767 TGGGCTCCTCTCCCACTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055373267 Original CRISPR TGGGCTCCTCTCCCACTTGA GGG Intergenic
No off target data available for this crispr