ID: 1055374862

View in Genome Browser
Species Human (GRCh38)
Location 9:75637666-75637688
Sequence GGTTCCAGTGCACTAGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055374860_1055374862 -9 Left 1055374860 9:75637652-75637674 CCCAGCTTTCATTGGGTTCCAGT No data
Right 1055374862 9:75637666-75637688 GGTTCCAGTGCACTAGTAGATGG No data
1055374861_1055374862 -10 Left 1055374861 9:75637653-75637675 CCAGCTTTCATTGGGTTCCAGTG No data
Right 1055374862 9:75637666-75637688 GGTTCCAGTGCACTAGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055374862 Original CRISPR GGTTCCAGTGCACTAGTAGA TGG Intergenic
No off target data available for this crispr