ID: 1055376556

View in Genome Browser
Species Human (GRCh38)
Location 9:75654844-75654866
Sequence TAAACCCACAAGATGTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055376556_1055376565 20 Left 1055376556 9:75654844-75654866 CCACAAAACATCTTGTGGGTTTA No data
Right 1055376565 9:75654887-75654909 AGGTAGCAGGCGGGTTGCGGGGG No data
1055376556_1055376561 11 Left 1055376556 9:75654844-75654866 CCACAAAACATCTTGTGGGTTTA No data
Right 1055376561 9:75654878-75654900 AGATTCAAAAGGTAGCAGGCGGG No data
1055376556_1055376560 10 Left 1055376556 9:75654844-75654866 CCACAAAACATCTTGTGGGTTTA No data
Right 1055376560 9:75654877-75654899 TAGATTCAAAAGGTAGCAGGCGG No data
1055376556_1055376563 18 Left 1055376556 9:75654844-75654866 CCACAAAACATCTTGTGGGTTTA No data
Right 1055376563 9:75654885-75654907 AAAGGTAGCAGGCGGGTTGCGGG No data
1055376556_1055376559 7 Left 1055376556 9:75654844-75654866 CCACAAAACATCTTGTGGGTTTA No data
Right 1055376559 9:75654874-75654896 TACTAGATTCAAAAGGTAGCAGG No data
1055376556_1055376566 25 Left 1055376556 9:75654844-75654866 CCACAAAACATCTTGTGGGTTTA No data
Right 1055376566 9:75654892-75654914 GCAGGCGGGTTGCGGGGGTCAGG No data
1055376556_1055376562 17 Left 1055376556 9:75654844-75654866 CCACAAAACATCTTGTGGGTTTA No data
Right 1055376562 9:75654884-75654906 AAAAGGTAGCAGGCGGGTTGCGG No data
1055376556_1055376558 0 Left 1055376556 9:75654844-75654866 CCACAAAACATCTTGTGGGTTTA No data
Right 1055376558 9:75654867-75654889 GTGGCTTTACTAGATTCAAAAGG No data
1055376556_1055376564 19 Left 1055376556 9:75654844-75654866 CCACAAAACATCTTGTGGGTTTA No data
Right 1055376564 9:75654886-75654908 AAGGTAGCAGGCGGGTTGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055376556 Original CRISPR TAAACCCACAAGATGTTTTG TGG (reversed) Intergenic
No off target data available for this crispr