ID: 1055379310

View in Genome Browser
Species Human (GRCh38)
Location 9:75688901-75688923
Sequence GACTTGCCATTTAAGAGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055379303_1055379310 23 Left 1055379303 9:75688855-75688877 CCTGCAGGGTCAGGGACTAGATG No data
Right 1055379310 9:75688901-75688923 GACTTGCCATTTAAGAGCTAGGG No data
1055379302_1055379310 24 Left 1055379302 9:75688854-75688876 CCCTGCAGGGTCAGGGACTAGAT No data
Right 1055379310 9:75688901-75688923 GACTTGCCATTTAAGAGCTAGGG No data
1055379307_1055379310 -10 Left 1055379307 9:75688888-75688910 CCTTACCTCAAAGGACTTGCCAT No data
Right 1055379310 9:75688901-75688923 GACTTGCCATTTAAGAGCTAGGG No data
1055379306_1055379310 -6 Left 1055379306 9:75688884-75688906 CCAGCCTTACCTCAAAGGACTTG No data
Right 1055379310 9:75688901-75688923 GACTTGCCATTTAAGAGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055379310 Original CRISPR GACTTGCCATTTAAGAGCTA GGG Intergenic
No off target data available for this crispr