ID: 1055379702

View in Genome Browser
Species Human (GRCh38)
Location 9:75692782-75692804
Sequence CAGGGAATACAGAAAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055379702_1055379705 14 Left 1055379702 9:75692782-75692804 CCATCTTCTTTCTGTATTCCCTG No data
Right 1055379705 9:75692819-75692841 AAGATGTCCCCAAAGCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055379702 Original CRISPR CAGGGAATACAGAAAGAAGA TGG (reversed) Intergenic
No off target data available for this crispr