ID: 1055384246

View in Genome Browser
Species Human (GRCh38)
Location 9:75743916-75743938
Sequence GAAAGCAGGAATAATACTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055384246_1055384250 12 Left 1055384246 9:75743916-75743938 CCAGGAGTATTATTCCTGCTTTC No data
Right 1055384250 9:75743951-75743973 TAGCTCTGAGTTTTGTGTAAGGG No data
1055384246_1055384251 18 Left 1055384246 9:75743916-75743938 CCAGGAGTATTATTCCTGCTTTC No data
Right 1055384251 9:75743957-75743979 TGAGTTTTGTGTAAGGGAAGAGG No data
1055384246_1055384249 11 Left 1055384246 9:75743916-75743938 CCAGGAGTATTATTCCTGCTTTC No data
Right 1055384249 9:75743950-75743972 ATAGCTCTGAGTTTTGTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055384246 Original CRISPR GAAAGCAGGAATAATACTCC TGG (reversed) Intergenic
No off target data available for this crispr