ID: 1055391369

View in Genome Browser
Species Human (GRCh38)
Location 9:75825592-75825614
Sequence AGTAGGACATGAAGCAGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055391369_1055391372 -5 Left 1055391369 9:75825592-75825614 CCTTTACTGCTTCATGTCCTACT No data
Right 1055391372 9:75825610-75825632 CTACTGTTTGTAAAGTAAGAGGG No data
1055391369_1055391371 -6 Left 1055391369 9:75825592-75825614 CCTTTACTGCTTCATGTCCTACT No data
Right 1055391371 9:75825609-75825631 CCTACTGTTTGTAAAGTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055391369 Original CRISPR AGTAGGACATGAAGCAGTAA AGG (reversed) Intergenic
No off target data available for this crispr