ID: 1055391372

View in Genome Browser
Species Human (GRCh38)
Location 9:75825610-75825632
Sequence CTACTGTTTGTAAAGTAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055391368_1055391372 13 Left 1055391368 9:75825574-75825596 CCAGCTGATGGAAAAAAACCTTT No data
Right 1055391372 9:75825610-75825632 CTACTGTTTGTAAAGTAAGAGGG No data
1055391369_1055391372 -5 Left 1055391369 9:75825592-75825614 CCTTTACTGCTTCATGTCCTACT No data
Right 1055391372 9:75825610-75825632 CTACTGTTTGTAAAGTAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055391372 Original CRISPR CTACTGTTTGTAAAGTAAGA GGG Intergenic
No off target data available for this crispr