ID: 1055391545

View in Genome Browser
Species Human (GRCh38)
Location 9:75827204-75827226
Sequence TCAACTGTGGAATTTTATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055391545_1055391550 28 Left 1055391545 9:75827204-75827226 CCTCCATAAAATTCCACAGTTGA No data
Right 1055391550 9:75827255-75827277 AAGCAAAAGCAGAATGTGGATGG No data
1055391545_1055391549 24 Left 1055391545 9:75827204-75827226 CCTCCATAAAATTCCACAGTTGA No data
Right 1055391549 9:75827251-75827273 TTACAAGCAAAAGCAGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055391545 Original CRISPR TCAACTGTGGAATTTTATGG AGG (reversed) Intergenic
No off target data available for this crispr