ID: 1055391547

View in Genome Browser
Species Human (GRCh38)
Location 9:75827217-75827239
Sequence TATTTCAGGATTTTCAACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055391547_1055391549 11 Left 1055391547 9:75827217-75827239 CCACAGTTGAAAATCCTGAAATA No data
Right 1055391549 9:75827251-75827273 TTACAAGCAAAAGCAGAATGTGG No data
1055391547_1055391550 15 Left 1055391547 9:75827217-75827239 CCACAGTTGAAAATCCTGAAATA No data
Right 1055391550 9:75827255-75827277 AAGCAAAAGCAGAATGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055391547 Original CRISPR TATTTCAGGATTTTCAACTG TGG (reversed) Intergenic
No off target data available for this crispr