ID: 1055391550

View in Genome Browser
Species Human (GRCh38)
Location 9:75827255-75827277
Sequence AAGCAAAAGCAGAATGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055391546_1055391550 25 Left 1055391546 9:75827207-75827229 CCATAAAATTCCACAGTTGAAAA No data
Right 1055391550 9:75827255-75827277 AAGCAAAAGCAGAATGTGGATGG No data
1055391547_1055391550 15 Left 1055391547 9:75827217-75827239 CCACAGTTGAAAATCCTGAAATA No data
Right 1055391550 9:75827255-75827277 AAGCAAAAGCAGAATGTGGATGG No data
1055391548_1055391550 1 Left 1055391548 9:75827231-75827253 CCTGAAATAGATTAGTGTCTTTA No data
Right 1055391550 9:75827255-75827277 AAGCAAAAGCAGAATGTGGATGG No data
1055391545_1055391550 28 Left 1055391545 9:75827204-75827226 CCTCCATAAAATTCCACAGTTGA No data
Right 1055391550 9:75827255-75827277 AAGCAAAAGCAGAATGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055391550 Original CRISPR AAGCAAAAGCAGAATGTGGA TGG Intergenic
No off target data available for this crispr