ID: 1055391876

View in Genome Browser
Species Human (GRCh38)
Location 9:75830813-75830835
Sequence CCGTGGAAGGATCCAAGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055391876_1055391880 -3 Left 1055391876 9:75830813-75830835 CCACATCTTGGATCCTTCCACGG No data
Right 1055391880 9:75830833-75830855 CGGCCCCAGTTTCCATCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055391876 Original CRISPR CCGTGGAAGGATCCAAGATG TGG (reversed) Intergenic
No off target data available for this crispr