ID: 1055392066

View in Genome Browser
Species Human (GRCh38)
Location 9:75833638-75833660
Sequence GAGGCTGGTGGTCCTCAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055392066_1055392071 3 Left 1055392066 9:75833638-75833660 CCAATTTGAGGACCACCAGCCTC No data
Right 1055392071 9:75833664-75833686 CACTTTATTCTTGCAGCATCTGG No data
1055392066_1055392072 4 Left 1055392066 9:75833638-75833660 CCAATTTGAGGACCACCAGCCTC No data
Right 1055392072 9:75833665-75833687 ACTTTATTCTTGCAGCATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055392066 Original CRISPR GAGGCTGGTGGTCCTCAAAT TGG (reversed) Intergenic
No off target data available for this crispr