ID: 1055392236

View in Genome Browser
Species Human (GRCh38)
Location 9:75835418-75835440
Sequence AGCTATGTGTTACAGTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055392225_1055392236 29 Left 1055392225 9:75835366-75835388 CCATTGATATGGGTGAGATTATA No data
Right 1055392236 9:75835418-75835440 AGCTATGTGTTACAGTAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055392236 Original CRISPR AGCTATGTGTTACAGTAGGG AGG Intergenic
No off target data available for this crispr