ID: 1055392705

View in Genome Browser
Species Human (GRCh38)
Location 9:75840362-75840384
Sequence ACAGTATGTAGAATTGCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055392704_1055392705 2 Left 1055392704 9:75840337-75840359 CCAGCTTGACAATAAACAATACA No data
Right 1055392705 9:75840362-75840384 ACAGTATGTAGAATTGCTTCAGG No data
1055392703_1055392705 11 Left 1055392703 9:75840328-75840350 CCATGTTAACCAGCTTGACAATA No data
Right 1055392705 9:75840362-75840384 ACAGTATGTAGAATTGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055392705 Original CRISPR ACAGTATGTAGAATTGCTTC AGG Intergenic
No off target data available for this crispr