ID: 1055395096

View in Genome Browser
Species Human (GRCh38)
Location 9:75865722-75865744
Sequence TTTTCCAGGCTGAGGGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055395096_1055395101 -5 Left 1055395096 9:75865722-75865744 CCAACCACCCTCAGCCTGGAAAA No data
Right 1055395101 9:75865740-75865762 GAAAACTCCCTTTCACAACATGG No data
1055395096_1055395104 6 Left 1055395096 9:75865722-75865744 CCAACCACCCTCAGCCTGGAAAA No data
Right 1055395104 9:75865751-75865773 TTCACAACATGGAAAGATAGAGG No data
1055395096_1055395105 25 Left 1055395096 9:75865722-75865744 CCAACCACCCTCAGCCTGGAAAA No data
Right 1055395105 9:75865770-75865792 GAGGAAAGAAGAAAGAACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055395096 Original CRISPR TTTTCCAGGCTGAGGGTGGT TGG (reversed) Intergenic
No off target data available for this crispr