ID: 1055395823

View in Genome Browser
Species Human (GRCh38)
Location 9:75873943-75873965
Sequence GAGGACAGTACCAAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055395817_1055395823 4 Left 1055395817 9:75873916-75873938 CCAGATTTTGCAAGAACTCACTG No data
Right 1055395823 9:75873943-75873965 GAGGACAGTACCAAGGTGGGTGG No data
1055395816_1055395823 22 Left 1055395816 9:75873898-75873920 CCACACAGTTTTAAATAACCAGA No data
Right 1055395823 9:75873943-75873965 GAGGACAGTACCAAGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055395823 Original CRISPR GAGGACAGTACCAAGGTGGG TGG Intergenic
No off target data available for this crispr