ID: 1055395823 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:75873943-75873965 |
Sequence | GAGGACAGTACCAAGGTGGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1055395817_1055395823 | 4 | Left | 1055395817 | 9:75873916-75873938 | CCAGATTTTGCAAGAACTCACTG | No data | ||
Right | 1055395823 | 9:75873943-75873965 | GAGGACAGTACCAAGGTGGGTGG | No data | ||||
1055395816_1055395823 | 22 | Left | 1055395816 | 9:75873898-75873920 | CCACACAGTTTTAAATAACCAGA | No data | ||
Right | 1055395823 | 9:75873943-75873965 | GAGGACAGTACCAAGGTGGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1055395823 | Original CRISPR | GAGGACAGTACCAAGGTGGG TGG | Intergenic | ||
No off target data available for this crispr |