ID: 1055397632

View in Genome Browser
Species Human (GRCh38)
Location 9:75891512-75891534
Sequence GTGCGTACGCGCGCGCGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 1, 2: 11, 3: 43, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055397632_1055397634 22 Left 1055397632 9:75891512-75891534 CCTGCGCGCGCGCGCGTACGCAC 0: 1
1: 1
2: 11
3: 43
4: 164
Right 1055397634 9:75891557-75891579 ACACACACCCCAGAGTTGCCGGG 0: 1
1: 0
2: 2
3: 26
4: 228
1055397632_1055397633 21 Left 1055397632 9:75891512-75891534 CCTGCGCGCGCGCGCGTACGCAC 0: 1
1: 1
2: 11
3: 43
4: 164
Right 1055397633 9:75891556-75891578 CACACACACCCCAGAGTTGCCGG 0: 1
1: 0
2: 2
3: 39
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055397632 Original CRISPR GTGCGTACGCGCGCGCGCGC AGG (reversed) Intronic