ID: 1055397632 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:75891512-75891534 |
| Sequence | GTGCGTACGCGCGCGCGCGC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 220 | |||
| Summary | {0: 1, 1: 1, 2: 11, 3: 43, 4: 164} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1055397632_1055397634 | 22 | Left | 1055397632 | 9:75891512-75891534 | CCTGCGCGCGCGCGCGTACGCAC | 0: 1 1: 1 2: 11 3: 43 4: 164 |
||
| Right | 1055397634 | 9:75891557-75891579 | ACACACACCCCAGAGTTGCCGGG | 0: 1 1: 0 2: 2 3: 26 4: 228 |
||||
| 1055397632_1055397633 | 21 | Left | 1055397632 | 9:75891512-75891534 | CCTGCGCGCGCGCGCGTACGCAC | 0: 1 1: 1 2: 11 3: 43 4: 164 |
||
| Right | 1055397633 | 9:75891556-75891578 | CACACACACCCCAGAGTTGCCGG | 0: 1 1: 0 2: 2 3: 39 4: 299 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1055397632 | Original CRISPR | GTGCGTACGCGCGCGCGCGC AGG (reversed) | Intronic | ||