ID: 1055397887

View in Genome Browser
Species Human (GRCh38)
Location 9:75892597-75892619
Sequence GCCGGCGGAGTGGGAGAGTA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055397880_1055397887 10 Left 1055397880 9:75892564-75892586 CCAGGGGGAAGGGAGAGGGAGGT 0: 1
1: 1
2: 14
3: 95
4: 891
Right 1055397887 9:75892597-75892619 GCCGGCGGAGTGGGAGAGTACGG No data
1055397874_1055397887 23 Left 1055397874 9:75892551-75892573 CCTGCGTGCTCTGCCAGGGGGAA 0: 1
1: 0
2: 1
3: 12
4: 119
Right 1055397887 9:75892597-75892619 GCCGGCGGAGTGGGAGAGTACGG No data
1055397873_1055397887 24 Left 1055397873 9:75892550-75892572 CCCTGCGTGCTCTGCCAGGGGGA 0: 1
1: 0
2: 1
3: 13
4: 123
Right 1055397887 9:75892597-75892619 GCCGGCGGAGTGGGAGAGTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055397887 Original CRISPR GCCGGCGGAGTGGGAGAGTA CGG Intronic
No off target data available for this crispr