ID: 1055398603

View in Genome Browser
Species Human (GRCh38)
Location 9:75899491-75899513
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 506
Summary {0: 2, 1: 1, 2: 9, 3: 78, 4: 416}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055398603_1055398609 17 Left 1055398603 9:75899491-75899513 CCTACATAACTGTGAGTTTGTAC 0: 2
1: 1
2: 9
3: 78
4: 416
Right 1055398609 9:75899531-75899553 CCTCCTCCCTCTCCTCACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055398603 Original CRISPR GTACAAACTCACAGTTATGT AGG (reversed) Intronic
904627506 1:31815255-31815277 GTAAAAGCTCACAGTTGTGTTGG + Exonic
905506906 1:38487151-38487173 GTACAAAGTTGTAGTTATGTAGG - Intergenic
907839860 1:58146460-58146482 GTACAAACTTGCAGTAATGCAGG - Intronic
908144389 1:61223461-61223483 GTACAAACTTACAGTTTTTCAGG + Intronic
908387576 1:63656860-63656882 GTACAAAATTTCAGTTATGTAGG + Intronic
909399490 1:75211126-75211148 GTACAAACTTTCAGTTATGCAGG - Intronic
909731751 1:78900371-78900393 GTATTATCTCACAGTTCTGTAGG - Intronic
910220593 1:84886143-84886165 GTACGAAGTTGCAGTTATGTAGG - Intronic
910576413 1:88769841-88769863 GTACATACTTAGAGTTAGGTAGG + Intronic
910611708 1:89151162-89151184 GTACAAACTTGAAGTTATATAGG - Intronic
910763106 1:90754626-90754648 GTACAAAATTACAGTTAGGAAGG - Intergenic
910896759 1:92078048-92078070 GTACAAAGTTGCATTTATGTAGG - Intergenic
912205866 1:107508947-107508969 GTACAAACATACAGTTAGATAGG + Intergenic
913019127 1:114768800-114768822 GTATTATCTCACAGTTCTGTAGG - Intergenic
913414262 1:118588123-118588145 GTACAAAGTTTCAGTTACGTAGG + Intergenic
913422786 1:118691055-118691077 GTGCAAAGTTTCAGTTATGTAGG - Intergenic
914953140 1:152136596-152136618 GTACAAAGTTTCAGTTATGCAGG + Intergenic
915989974 1:160504151-160504173 GTACAAAGTTGCAGATATGTAGG + Intronic
916629489 1:166596324-166596346 GGACAAACTTACAGTATTGTGGG + Intergenic
917360594 1:174171590-174171612 GTACAAACTCGCAGTTATGTAGG - Intronic
917578780 1:176351745-176351767 GTACAAAGTTTCAGTTATGCAGG - Intergenic
918597889 1:186314205-186314227 GTACAATCTAAAAGTTATATTGG + Exonic
919552341 1:199006588-199006610 GTACAAACAAAGAGTTATTTGGG - Intergenic
919696805 1:200585114-200585136 GTACAAAGTTTCAGTTATGCAGG + Intronic
921617752 1:217291351-217291373 GTACAAAATTACAGTTAGATAGG - Intergenic
922087998 1:222369425-222369447 GTACAACATAGCAGTTATGTCGG - Intergenic
923259995 1:232259319-232259341 GTACAAAGTTGCAGTTATGTAGG - Intergenic
924232573 1:241974790-241974812 GTACAAAGTTGCAGTTATGTTGG - Intergenic
924867068 1:247994639-247994661 CTACAAACTTGAAGTTATGTAGG + Intronic
1063757583 10:9032114-9032136 GTACAAAGTTGTAGTTATGTAGG + Intergenic
1064009815 10:11726785-11726807 GTACAAAGTCCCAGTTATGCAGG + Intergenic
1065248121 10:23780379-23780401 GTACAAAGTTTCAGTTATATAGG - Intronic
1066013071 10:31211938-31211960 GTACAAAGTTGCAGTTATATAGG - Intergenic
1067827228 10:49585624-49585646 GTACAAAGTTACAGTTAGATTGG + Intergenic
1068517577 10:58043572-58043594 ATATAAGCTCACAGTTCTGTAGG + Intergenic
1068640993 10:59407671-59407693 GTGCAAAGTTACAGTTATATAGG - Intergenic
1068926341 10:62543285-62543307 GCACAAAGTTGCAGTTATGTAGG + Intronic
1069101334 10:64324714-64324736 GTACAAAATTGCAGTTATGTAGG + Intergenic
1069229280 10:65988071-65988093 GTACAAAAATACAGTTATATAGG + Intronic
1070049371 10:72872351-72872373 GTACAAAATTACAGTTAGATAGG - Intronic
1070352658 10:75608363-75608385 GTACAAAGTTTCAGTTATGTAGG + Intronic
1071236476 10:83656243-83656265 GCACAAAGTTGCAGTTATGTGGG - Intergenic
1071362244 10:84860342-84860364 ATACAAAGTAACAGATATGTAGG - Intergenic
1071811178 10:89183173-89183195 GTACAAACTGACAGTATTGAGGG + Intergenic
1073387607 10:103139861-103139883 GTACAAAGTTGCAGTTATGTTGG - Intronic
1073813123 10:107173259-107173281 GTACAAAGTTACAGTTATATAGG + Intergenic
1074655031 10:115575854-115575876 GTACAAACTTGAAGTTAGGTAGG - Intronic
1074675635 10:115847247-115847269 GTACAAACTTGCACTTATGTAGG + Intronic
1075076463 10:119354362-119354384 GCACAAAGTTGCAGTTATGTAGG - Intronic
1077725221 11:4667628-4667650 GTACAAAATTTCAGTTATGTGGG + Intergenic
1077753144 11:4995976-4995998 ATACAAACTTGCAGTTATGTAGG + Intergenic
1077771480 11:5223795-5223817 GTATAAAATTTCAGTTATGTGGG - Intergenic
1077949162 11:6936195-6936217 GTACCAACTTTCAGTTTTGTTGG - Intronic
1078648941 11:13169126-13169148 GTACAAAATGTCAGTTATGCAGG + Intergenic
1078734104 11:14003884-14003906 ATACAAAATAACAGTTATATAGG - Intronic
1078958271 11:16228542-16228564 GTACAAAGTTGCAGGTATGTAGG + Intronic
1079662502 11:23057538-23057560 GTACAAAGTTACAGTTACATAGG + Intergenic
1079793501 11:24769273-24769295 GTACAAAGTTAAAGTTAGGTAGG + Intronic
1081253596 11:40865335-40865357 GTACAAAATTACAGTTAGATAGG + Intronic
1081393932 11:42562669-42562691 GTACAAGAGCACAGTTATATGGG + Intergenic
1082211235 11:49504673-49504695 GTATAAAGTTACAGTTATGAAGG + Intergenic
1083131397 11:60626454-60626476 GTGCAAACTTGCAGTGATGTAGG + Intergenic
1084388037 11:68856301-68856323 TTCCAAACTCACTGTTAAGTGGG - Intergenic
1084866802 11:72064952-72064974 ATACAAACTCACAAGTATGTGGG - Intronic
1086028598 11:82325249-82325271 GTACAAAGTTGCAGTTATGCAGG - Intergenic
1086484922 11:87289392-87289414 ATACAAAATCACAGCTATGTAGG - Intronic
1086720621 11:90116811-90116833 ATACAAAATTACAGTTAGGTAGG + Intergenic
1086809435 11:91288660-91288682 AGACAAATTCACAGTTATGATGG + Intergenic
1087436915 11:98131762-98131784 GGTCAAACTCACATCTATGTGGG - Intergenic
1087505168 11:99011789-99011811 GTACAAACTTGCAGTTATGTAGG + Intergenic
1088067769 11:105741892-105741914 GTACAAACTTGCAGTTATGTAGG + Intronic
1088187341 11:107186041-107186063 GTACAAAGTTGCAGTTATGCAGG - Intergenic
1088443611 11:109899987-109900009 TTACAAAGCCACAGTTAGGTAGG + Intergenic
1088547781 11:110978298-110978320 GTACAAAGTTACAGTTAGATAGG + Intergenic
1088946652 11:114520216-114520238 GTACAAACTTGCAGTTCTATTGG - Intergenic
1090135718 11:124197581-124197603 GTACAAAGTTGCAGTTATGTAGG - Intergenic
1091022701 11:132115181-132115203 GTACAAAGTTTCAGTTACGTAGG + Intronic
1092632538 12:10397987-10398009 GTACAAAGTTATAGTTAGGTAGG - Intronic
1094036769 12:26080316-26080338 GTACGAACTTGCCGTTATGTAGG + Intergenic
1094079660 12:26519254-26519276 GTACAAACACACACGTGTGTGGG + Intronic
1095281532 12:40357029-40357051 GTACAAACATACAGTTAGATAGG - Intronic
1095324848 12:40877052-40877074 GTTCATACTCACAATTATTTTGG - Intronic
1095499510 12:42821265-42821287 GTACAAAATTACAGTTAGATAGG - Intergenic
1096065350 12:48735287-48735309 TTATAATCTCACAGTTCTGTAGG - Intergenic
1097474102 12:60033013-60033035 CCACACACTTACAGTTATGTTGG - Intergenic
1097481728 12:60135074-60135096 GTACAAACGTTCAGTGATGTAGG + Intergenic
1097626318 12:62005063-62005085 GTTCAAAATTGCAGTTATGTAGG + Intronic
1098299454 12:69039131-69039153 GTTCAAAATCACAGTTATGTTGG - Intergenic
1098373965 12:69792185-69792207 GTACAAAGTGTCAGTTATGCAGG + Intronic
1099436728 12:82654987-82655009 GTAAGATCTCACAGTTCTGTAGG + Intergenic
1099539430 12:83887858-83887880 GTACAAACTTGCAGTTATATGGG - Intergenic
1099950753 12:89300170-89300192 GTACAAAGTTACAGTTAGATAGG + Intergenic
1099994655 12:89765046-89765068 TTACAAACTCATAGTTTTATTGG - Intergenic
1100954901 12:99896191-99896213 GTATAAAATTTCAGTTATGTAGG - Intronic
1101210125 12:102527009-102527031 GTTGAAAGTCAAAGTTATGTAGG + Intergenic
1101459252 12:104873122-104873144 CTACAAAGTTGCAGTTATGTAGG - Intronic
1102671910 12:114626970-114626992 GTACATTCTCAGAGTTATGTGGG + Intergenic
1102733283 12:115133936-115133958 GTACAAAATCACAGCTAGATAGG + Intergenic
1103103478 12:118201920-118201942 GTACAAAGTTTTAGTTATGTGGG - Intronic
1104187482 12:126446626-126446648 GTACAAAATCTCACTTATGCAGG + Intergenic
1104374855 12:128255913-128255935 TTACTACCTCACAGTTCTGTAGG - Intergenic
1105589841 13:21781942-21781964 GTACAAAGTTTCAGTTGTGTAGG - Intergenic
1105816975 13:24044934-24044956 GTACAAAGTTACAGTTAGATAGG + Intronic
1106301087 13:28466168-28466190 GTAGAAACTCACAGTAAAATTGG - Intronic
1106754100 13:32804256-32804278 GTACAAAGTTTCAGTTATGTGGG + Intergenic
1107888899 13:44896868-44896890 GTACTCTCTCACAGTTATGGAGG + Intergenic
1108190905 13:47938187-47938209 GTATTATCTCACAGTTCTGTAGG + Intronic
1108424106 13:50280682-50280704 ATACAAAGTTACAGTTGTGTAGG - Intronic
1108465859 13:50714871-50714893 TTACTACCTCACAGTTCTGTAGG + Intronic
1108850501 13:54722380-54722402 GTACAAAGTTTCAGTTATGTAGG - Intergenic
1109425381 13:62160238-62160260 GTACAAACTTGCAGTTATGTAGG + Intergenic
1109674140 13:65651813-65651835 GTACAGACTTTCAGTTCTGTAGG - Intergenic
1109713684 13:66191972-66191994 GTACAAAGTTATAGTTATGTAGG + Intergenic
1110905458 13:80882128-80882150 GTCCAAACCCTCAGTTTTGTTGG + Intergenic
1111037822 13:82702793-82702815 GTACAAAGTTGCAGTTAGGTAGG - Intergenic
1111300016 13:86336769-86336791 GTACAAAGTTGCAGTTATGTAGG + Intergenic
1111447392 13:88365412-88365434 GTACAAAGTTACAGTTAAATGGG - Intergenic
1111555700 13:89878881-89878903 GTACAAAGTTGCAGTTATATTGG - Intergenic
1111926260 13:94466266-94466288 GTGCAAAGTTGCAGTTATGTAGG + Intronic
1112685969 13:101827412-101827434 ATAAAAACTCACATTTATTTTGG - Intronic
1112813464 13:103246282-103246304 GTAGAGACTCACAGCTCTGTAGG - Intergenic
1112850965 13:103706156-103706178 TAACAAAATCACAGTTTTGTTGG - Intergenic
1113079409 13:106502029-106502051 GTATAAACTATCAGTGATGTAGG + Intronic
1113210641 13:107975708-107975730 GTATTATCTCACAGTTCTGTAGG - Intergenic
1114970432 14:28020184-28020206 TTACAAATTCACAGTTCTATGGG - Intergenic
1115093542 14:29607342-29607364 GTATTATCTCACAGTTCTGTAGG + Intronic
1115162545 14:30412167-30412189 TTACAATCTTACAGTTCTGTAGG + Intergenic
1115681693 14:35746286-35746308 GTACAAAGGTTCAGTTATGTGGG + Intronic
1115695221 14:35890578-35890600 GTATAAACACACAGTTAGATAGG - Intronic
1116168692 14:41369904-41369926 GAAGACACACACAGTTATGTTGG + Intergenic
1116316691 14:43405377-43405399 GTACAAAGTTACAGTTAGATAGG + Intergenic
1116640673 14:47458536-47458558 GTACAAAGTTTCAGTTATGCTGG + Intronic
1116775222 14:49171830-49171852 GTACAAAGTTGCAATTATGTAGG + Intergenic
1117461463 14:55949388-55949410 GTACAAAGTTTCAGTTATGTGGG - Intergenic
1117999273 14:61507804-61507826 GTACAAAATTTCAGTTATGCAGG + Intronic
1118058750 14:62112292-62112314 GTTCAGTCTCACAGTGATGTTGG + Exonic
1118136282 14:63031623-63031645 ATACAAGCTGGCAGTTATGTAGG + Intronic
1119106004 14:71924502-71924524 GGACAAAATAGCAGTTATGTAGG - Intergenic
1119314729 14:73683561-73683583 GTACCAAGTTACAATTATGTAGG - Intronic
1119833900 14:77729558-77729580 GTACAAAGTCTCATTTATGCAGG + Intronic
1120146036 14:80979407-80979429 GTATAAAGTTACAGTTAGGTAGG + Intronic
1120217700 14:81697780-81697802 GTACAAACTTGCAGTTACATAGG - Intergenic
1120284389 14:82479758-82479780 GTAGAAAGTTGCAGTTATGTTGG + Intergenic
1120830792 14:88995796-88995818 ATACAAACTCACAGACATGTGGG + Intergenic
1122821913 14:104351406-104351428 GTATAAAATTGCAGTTATGTGGG - Intergenic
1124666278 15:31595634-31595656 TTACTATCTCACAGTTTTGTAGG + Intronic
1126305606 15:47252501-47252523 GTACAAAGTAACAGTTAGATAGG - Intronic
1127537797 15:59906800-59906822 CTACAAACTGACAGGTTTGTAGG + Intergenic
1127952682 15:63824965-63824987 GAACAAAGTTGCAGTTATGTAGG + Intronic
1130056169 15:80527935-80527957 CTACAAACTCCCAGGAATGTAGG - Intronic
1131350063 15:91691662-91691684 GTTCAAAATTGCAGTTATGTAGG + Intergenic
1131844686 15:96476650-96476672 GTGCAAAGTTGCAGTTATGTAGG - Intergenic
1133921410 16:10156572-10156594 GAATAAATTCACAGTCATGTGGG + Intronic
1135886525 16:26314536-26314558 GTACAAAGTCACAGTCAGATAGG - Intergenic
1137991969 16:53166854-53166876 ATACAAACACATACTTATGTAGG - Intronic
1138637292 16:58351093-58351115 GTACAAAATCACAGTTAGACAGG + Intronic
1142947457 17:3443984-3444006 GTACAAACTTGCAATTATGTAGG - Intronic
1146135348 17:30315571-30315593 CTACAAGCTCCCAGTTGTGTGGG + Intergenic
1147516426 17:41122099-41122121 GTGAAAACTCACAGGTATGCTGG - Intergenic
1149071113 17:52544403-52544425 AACAAAACTCACAGTTATGTAGG - Intergenic
1150286395 17:63956618-63956640 GTACAAAGGCACAGTTTTGTGGG - Intronic
1151591726 17:75048723-75048745 GTGCAAACTCCCACTGATGTTGG + Intronic
1153158245 18:2173647-2173669 GCACAGCCTCAGAGTTATGTTGG - Intergenic
1153252851 18:3139813-3139835 TTACAAACTCACAGGTATTTAGG + Intronic
1153558707 18:6347202-6347224 GTACAAAGTTTTAGTTATGTAGG + Intronic
1155060728 18:22226092-22226114 GTACAAAGTTGCAATTATGTAGG - Intergenic
1155631113 18:27894044-27894066 ATACAAAGTTATAGTTATGTAGG + Intergenic
1155837331 18:30602473-30602495 GTACAGAGTTGCAGTTATGTAGG - Intergenic
1156224802 18:35093805-35093827 GTACAAAGTTACAGTTAGGTAGG + Intronic
1156343312 18:36232592-36232614 GTACAAAATTACAGGTATATAGG - Intronic
1156440188 18:37178157-37178179 GTACAAAGTTACAGTTAGATAGG - Intronic
1156738314 18:40291604-40291626 GTGTAAACTTGCAGTTATGTAGG + Intergenic
1157056684 18:44237461-44237483 GTATTACCTCACAGTTCTGTAGG - Intergenic
1157338808 18:46760248-46760270 TTACAAGCTCACAGATGTGTAGG - Intergenic
1157428960 18:47607705-47607727 GTATTATCTCACAGTTCTGTAGG + Intergenic
1158665119 18:59425602-59425624 ATACAGACTCCCAGTTATTTTGG + Intergenic
1159235603 18:65669037-65669059 GTACAAAGCCACAATTATGCAGG - Intergenic
1159334700 18:67047282-67047304 GTACAAAGTCACAGTTAGATAGG - Intergenic
1159372642 18:67548086-67548108 GTACAAAGTTTCAGTTATGCAGG + Intergenic
1159964297 18:74580627-74580649 ATACAAACTCATAGAAATGTTGG + Intronic
1160264291 18:77326122-77326144 GTACAAAGTGACAATTATGTAGG - Intergenic
1160343988 18:78114745-78114767 GTACAAAGTCACAGTTGGATAGG - Intergenic
1160422710 18:78758580-78758602 GTCCAACCTCACAGTGCTGTGGG + Intergenic
1162042023 19:7976655-7976677 GTATCAACTCACAGTTCTGGAGG - Intronic
1162279680 19:9685526-9685548 GTATAATCTCACATATATGTGGG - Intergenic
1163096415 19:15060807-15060829 GTACAAAAGTACAGTTAGGTAGG + Intergenic
1163228278 19:15980062-15980084 GTAAAAACTCAGAGTTGTGTGGG - Intergenic
1164463250 19:28466004-28466026 GTGCAAACTTGCAGTTATGTAGG + Intergenic
1165398863 19:35584825-35584847 GTATTAACTCACAGTTCTGTAGG + Intergenic
1166030996 19:40127894-40127916 GTACAAAGTTTCAGTTATGTAGG + Intergenic
1166209498 19:41297040-41297062 GCACAAACTCTCAGGTATATCGG + Intronic
1166512911 19:43422016-43422038 GTACATAGTCACAGCTATTTGGG + Intergenic
1167776048 19:51557091-51557113 GTACAAACTTATAGTTATGAAGG + Intergenic
927734435 2:25506180-25506202 GTACAAACACAGAGTTAGATGGG + Intronic
927911937 2:26905831-26905853 TTATTAACTCACAGTTCTGTAGG + Intronic
929338303 2:40780247-40780269 GTACAAAGTTACAGTTAAGTAGG + Intergenic
930091842 2:47536436-47536458 GGACAAACTGTCAGTTCTGTTGG - Intronic
930247242 2:48996949-48996971 ATACAAACTCCCAGTTAAGAAGG - Intronic
930446615 2:51481636-51481658 TTACAAAGTTTCAGTTATGTAGG + Intergenic
930476525 2:51889098-51889120 GTACAAAGTTATAGTTATTTAGG + Intergenic
930575006 2:53135736-53135758 GTATTATCTCACAGTTTTGTAGG - Intergenic
931363544 2:61598972-61598994 GTACAAAGCTACAGTTATGTGGG + Intergenic
931910466 2:66894206-66894228 GTACAAAGTTACAGTTATATAGG - Intergenic
932206293 2:69886152-69886174 GTACAAACTTGCAGTTATGTAGG - Intergenic
933089829 2:78106610-78106632 GTACCTCCTCCCAGTTATGTGGG + Intergenic
936492747 2:112986981-112987003 CTACATAATTACAGTTATGTAGG - Intergenic
936829710 2:116628487-116628509 GTACAAAGTTACAGTTACATAGG + Intergenic
936944097 2:117915073-117915095 GGACAAAATCAGAGTTGTGTTGG + Intergenic
937538472 2:122920479-122920501 GTACAAAGTCGTAGTTATGTGGG - Intergenic
938164294 2:129012611-129012633 ATACAAAGTAGCAGTTATGTAGG - Intergenic
938227645 2:129629681-129629703 ACAAAACCTCACAGTTATGTGGG - Intergenic
938253012 2:129830607-129830629 GCACAAAGTTACAATTATGTAGG + Intergenic
938948304 2:136234522-136234544 GCACAAACCAACAGTTATGTGGG + Intergenic
939237304 2:139513241-139513263 GTACAAACTTGCAGCCATGTAGG - Intergenic
940072557 2:149705276-149705298 GTACAAAGTTACAGTTAATTAGG - Intergenic
940706820 2:157115874-157115896 GTACAAAATTTCAGTTATGCAGG + Intergenic
940988425 2:160073069-160073091 ATACAAATTTGCAGTTATGTAGG + Intergenic
942000012 2:171636797-171636819 GTACAAAGTTGCAGTTATATAGG - Intergenic
942516527 2:176759366-176759388 GTACAAAATCACAATTATACAGG - Intergenic
943138296 2:183943940-183943962 GTACAAACATACAGTTAGATGGG + Intergenic
943166985 2:184341878-184341900 ATACAAACTTGCAGTTATGTAGG - Intergenic
943219056 2:185080373-185080395 GTACACATTTGCAGTTATGTAGG + Intergenic
943973070 2:194436517-194436539 GTATAAAGTTACAGTTATGTAGG - Intergenic
944491291 2:200260321-200260343 GTACAAATTTGCAATTATGTAGG + Intergenic
945128166 2:206536477-206536499 GTACAAAGTTGCAGTTATATAGG + Intronic
945331745 2:208548052-208548074 CTACAAACTTAGTGTTATGTAGG - Intronic
946578289 2:221100269-221100291 GCACAAGCTCACAGGCATGTAGG + Intergenic
946821130 2:223630576-223630598 GGACAAACTGGCAGTTATGTAGG - Intergenic
947924466 2:233909092-233909114 GTACCAACTCACAGGTTTCTTGG + Intergenic
1169514086 20:6297423-6297445 GTACAAAGTGTCAGTTATGCAGG - Intergenic
1170170377 20:13404230-13404252 GAACAAAGTTAAAGTTATGTAGG + Intronic
1171092595 20:22299641-22299663 GTACAAACTTTCAGTTTTGCAGG - Intergenic
1171381259 20:24735839-24735861 GTACTAAGTCACAGTTAAGCAGG + Intergenic
1171566488 20:26195871-26195893 GTACAAACTGGCAGTCATGTAGG + Intergenic
1174328886 20:49802002-49802024 GTATTAGCTCACAGTTCTGTAGG + Intergenic
1174750394 20:53106192-53106214 GTACAAAATTACAGTTAGATAGG - Intronic
1174971347 20:55279339-55279361 GTACAGACTCATAATTATATTGG - Intergenic
1175573880 20:60045783-60045805 GTACAAAGTTACAGTTAAATAGG + Intergenic
1176520076 21:7817826-7817848 GTACTGACTCACAGTTCTGGAGG + Exonic
1177419165 21:20833134-20833156 CAACAAACTCACAGATACGTAGG + Intergenic
1177761731 21:25409223-25409245 GTACAATCTTTCAGTTATATAGG + Intergenic
1177855994 21:26400644-26400666 ATTCAAAGTCACAGTTATTTAGG - Intergenic
1178010459 21:28279668-28279690 GTACAAAATTACAGTTAGATAGG + Intergenic
1178236291 21:30845763-30845785 TGGCAAACTCACAGTTAGGTAGG - Intergenic
1178654103 21:34447838-34447860 GTACTGACTCACAGTTCTGGAGG + Intergenic
1180075792 21:45461165-45461187 GTACAAAGTTTCAGTTATGCAGG - Intronic
1181612328 22:24025467-24025489 GCACAAACCCACATTTTTGTAGG + Intronic
1181795429 22:25305311-25305333 GTATCATCTCACAGTTCTGTAGG - Intergenic
1182687024 22:32129036-32129058 GTATAAACACACAGAGATGTTGG - Intergenic
1184518249 22:44976421-44976443 GTACAAAGTTACAGTTAGGTGGG - Intronic
1185207941 22:49550933-49550955 GCAACAGCTCACAGTTATGTGGG + Intronic
949590485 3:5489224-5489246 TCATAAACTCACAGTTAAGTAGG - Intergenic
951314579 3:21173297-21173319 GTACAAAATTACAGTTAGATAGG - Intergenic
951770741 3:26254505-26254527 GTACAAACTCACAGTTATGTAGG - Intergenic
952014362 3:28939319-28939341 GTACAAAATAGCAGATATGTAGG + Intergenic
952674904 3:36016846-36016868 GTACAAAGTCTCAGTTATGTAGG - Intergenic
952675171 3:36021092-36021114 GTACAAAGATACAGTTAGGTAGG + Intergenic
953544155 3:43850214-43850236 AGACAAATTCACAATTATGTTGG - Intergenic
953780143 3:45861677-45861699 GGACAAAGTCACAGATAAGTAGG + Intronic
957111666 3:75968690-75968712 GTACAAACTGGCAGTCATGTAGG - Intronic
957354507 3:79063978-79064000 GTAAAAAGTCACAGTTATACAGG + Intronic
957445081 3:80306657-80306679 ATACTGACTCACAGTTATGGTGG - Intergenic
957527998 3:81402409-81402431 GTAAAAATGTACAGTTATGTAGG - Intergenic
958080932 3:88745275-88745297 GAAGAAACTCACAATTATTTTGG - Intergenic
958493439 3:94809301-94809323 GTACAAAGTTACAGTTATACAGG + Intergenic
958825350 3:99023044-99023066 GTACAATGTTTCAGTTATGTAGG + Intergenic
959110658 3:102118506-102118528 GTACAAAGTTTCAGTTATGCAGG - Intronic
959335607 3:105060872-105060894 GTACAAAGTTACAGTTAAATAGG + Intergenic
959365028 3:105446895-105446917 GTACAAAGTCACAGTTAGATAGG + Intronic
959397198 3:105855293-105855315 GTACAAATTTGAAGTTATGTAGG + Intronic
959594975 3:108119890-108119912 GTACAAAGTTACAGTTAGGCAGG + Intergenic
959768606 3:110065313-110065335 GTACGAACTTGTAGTTATGTAGG - Intergenic
961584704 3:127912730-127912752 ATACATACTTACAGTTATTTGGG - Intergenic
962366470 3:134788539-134788561 GTACAAAGTTGCAGTTATGCAGG + Intronic
962833183 3:139161852-139161874 TCTCAAACTCACAGTTATGATGG - Intronic
963829385 3:149990634-149990656 GTACATATTCACAAATATGTTGG + Intronic
963898171 3:150707862-150707884 GTACAAAGTTACAGTTAGATAGG - Intergenic
964213804 3:154256823-154256845 ATAGAAACTCACAGTTAAGAGGG - Exonic
964670726 3:159222574-159222596 TTACAAACTTGCAGTTATGTAGG + Intronic
965151142 3:164976851-164976873 GTACAAACTTACAGTTAGATAGG - Intergenic
966100371 3:176261941-176261963 GTACAAAATTACAGTTACATAGG - Intergenic
966664497 3:182455704-182455726 GTACAAAATTACAGTTAGATGGG - Intergenic
967448350 3:189594611-189594633 GTACAAAATTTCAGTTATGCAGG + Intergenic
967710508 3:192701977-192701999 GTAAAAAGTTTCAGTTATGTAGG - Intronic
967760437 3:193218270-193218292 GTGCAAAGTCATAGTTATATTGG + Intergenic
968259900 3:197312463-197312485 ATACAAACTCACAGTTAGACAGG - Intergenic
969146073 4:5125267-5125289 TTACTAACTCACTGTTCTGTAGG - Intronic
969192127 4:5530643-5530665 GTACAAACTTGCAGTCATGTAGG - Intergenic
969559008 4:7933887-7933909 GTATCATCTCACAGTTCTGTGGG - Intronic
970038336 4:11766740-11766762 ATACAAACTTGCACTTATGTAGG - Intergenic
970830163 4:20328857-20328879 GTACATACACACATTTATTTTGG - Intronic
971221682 4:24713662-24713684 GTACAAAGTTTCAGTTATTTGGG - Intergenic
971574002 4:28251083-28251105 GTATTATCTCACAGTTCTGTAGG - Intergenic
972015729 4:34242499-34242521 GTATTATCTCACAGTTATGAAGG - Intergenic
972115069 4:35621483-35621505 TTATTAACTCACAGTTATATAGG + Intergenic
972224166 4:36992859-36992881 GTATTAGCTCACAGTTGTGTAGG - Intergenic
972483835 4:39524105-39524127 GTAGAATCTCAAAGTAATGTTGG + Intronic
972645183 4:40961166-40961188 GTAATAAGTCACAGTTATTTTGG + Intronic
973042796 4:45494073-45494095 GTACAAAGCTACAGTTATGCAGG - Intergenic
974246304 4:59324100-59324122 GTACAAAGTATCAGTTATGCAGG - Intergenic
974457783 4:62149799-62149821 GTACAAAATTACAGTTACGTGGG + Intergenic
974980115 4:68945344-68945366 CAACAAACTCAAAGTTAGGTTGG + Exonic
976144662 4:82030861-82030883 ATACAAACTTGCAGGTATGTAGG - Intronic
976702238 4:87983673-87983695 GTACAAAGTTACAGTTAGCTAGG - Intergenic
976915303 4:90366597-90366619 GTACAAAATCTCAGAAATGTGGG - Intronic
977769714 4:100843467-100843489 GTACAAATTTGTAGTTATGTGGG + Intronic
978048116 4:104158522-104158544 GTAGAAACTTTCAGTTATGAAGG + Intergenic
978281040 4:107014530-107014552 GTACAAAGTTACAGTTAGATAGG + Intronic
979149512 4:117292187-117292209 ATACAAAGTCACAGATATGCAGG - Intergenic
979407838 4:120336950-120336972 GCATAAACTTGCAGTTATGTAGG - Intergenic
980015029 4:127639871-127639893 GTACAAAGTTACAGTTAGATAGG - Intronic
980047663 4:128006823-128006845 GTCCATAATCACAGTTATTTGGG + Intronic
980117628 4:128694897-128694919 GTACAAAGTTGTAGTTATGTAGG + Intergenic
980739701 4:136933178-136933200 GTACAAAAGTACATTTATGTAGG + Intergenic
980749676 4:137071786-137071808 GTACACAGTTGCAGTTATGTAGG - Intergenic
981012113 4:139935991-139936013 GTACAAAGTTTCAGTTATGCTGG - Intronic
981348939 4:143706372-143706394 GTACAAAGTTTCAGTTATGCAGG + Intergenic
982078237 4:151760761-151760783 GTTCCACCTCACAGTTAGGTGGG + Intronic
983006983 4:162495200-162495222 GTACAAGGTTGCAGTTATGTAGG + Intergenic
983377419 4:166947969-166947991 GTACAAAGTTACAGTTAGTTGGG - Intronic
984317208 4:178142256-178142278 GTAGCACCTCCCAGTTATGTGGG - Intergenic
984469986 4:180156364-180156386 GTACACAGTCACAGTAATTTAGG - Intergenic
985261740 4:188120680-188120702 GTACGAGCTCACAGTTCTGCAGG - Intergenic
986562532 5:9076639-9076661 GTATAAACTCATAGTTGTTTTGG - Intronic
987420450 5:17714374-17714396 GTACAAACTTGTAGTTATGTAGG - Intergenic
987565356 5:19577128-19577150 GTACAATGTTACAGTTAGGTAGG + Intronic
988174120 5:27698388-27698410 GCACAGACTTACAGTTACGTAGG - Intergenic
988881742 5:35511015-35511037 GTACAAAGTTGCAGTTATGTAGG + Intergenic
989539491 5:42602277-42602299 GTACAAAGTAGCAGTTATGAAGG - Intronic
989753947 5:44928836-44928858 GTACAAAGTTACAGTTAGATGGG - Intergenic
989991414 5:50771955-50771977 GTACAAAATCACAGTTCAGTAGG - Intronic
990070077 5:51771437-51771459 GTACAAAGTTATAGTTAAGTAGG - Intergenic
990907587 5:60820343-60820365 GTATTATCTCACAGTTCTGTAGG - Intronic
991181958 5:63762934-63762956 GAAACAACTCACAGTTGTGTGGG - Intergenic
991243711 5:64487416-64487438 GTACAAAATTACAGTTAGATAGG - Intergenic
991696608 5:69279051-69279073 GTATTAGCTCACAGTTCTGTAGG + Intergenic
992073328 5:73168812-73168834 GCTCAAACTTACAGTTGTGTGGG + Intergenic
992646566 5:78816977-78816999 TTACTACCTCACAGTTCTGTAGG - Intronic
993384438 5:87247357-87247379 TTACAAACTCACAGTTCTCTAGG - Intergenic
993529753 5:89009699-89009721 GTACAAAGTTTCAGTTATGGAGG - Intergenic
994283844 5:97939285-97939307 TAATAGACTCACAGTTATGTAGG - Intergenic
994302995 5:98168998-98169020 GGAGTAACTCACAGTTATGTTGG - Intergenic
994611169 5:102041928-102041950 GTACAAACTTTCAGTTATGAAGG + Intergenic
994941862 5:106333975-106333997 GAACAAACTAGCAGATATGTTGG - Intergenic
995165397 5:109034092-109034114 GTACAAAGTCTCAGTTAGATGGG - Intronic
995216214 5:109597788-109597810 AAACAGACTCACAGTTATCTGGG - Intergenic
995250183 5:109984242-109984264 GTACAAAGTGGCTGTTATGTAGG + Intergenic
995813616 5:116139996-116140018 ATATAAACTTGCAGTTATGTAGG - Intronic
996228477 5:121031688-121031710 GCACAATTTCACAGTGATGTTGG + Intergenic
996232707 5:121086449-121086471 GTACAAAAACACAGTTAGATAGG - Intergenic
996489311 5:124074150-124074172 GTATAAAATTACAGTTAGGTAGG - Intergenic
996607276 5:125338298-125338320 GTACAAAGTTACAGTTAGGTAGG - Intergenic
996632586 5:125652256-125652278 GTACAAAGTTTCAGTTAGGTAGG + Intergenic
997576060 5:134978194-134978216 GTACAAAGTTACAGTTAGATAGG + Intronic
998305073 5:141067992-141068014 GTATTATCTTACAGTTATGTAGG + Intergenic
998713639 5:144854858-144854880 GTACAAACTTTTAGTTGTGTTGG - Intergenic
999511095 5:152252545-152252567 ATACAAACTAGCAGATATGTAGG - Intergenic
1000571845 5:162924518-162924540 TTACTATCTCACAGTTCTGTAGG + Intergenic
1000913991 5:167057863-167057885 GTTAAAACTCACAAATATGTTGG + Intergenic
1001578564 5:172781966-172781988 GTACAAACTTTCAGTTATTGAGG + Intergenic
1001621901 5:173093873-173093895 GTACAAAGTTTCAGTTATGCAGG - Intronic
1002995366 6:2278088-2278110 GTACAAAGTTGCAGTTCTGTAGG - Intergenic
1003155039 6:3586219-3586241 TTATAAACTCACAGTTGTTTTGG + Intergenic
1004957572 6:20746949-20746971 GTACAAAGTTGCAGTTATGTAGG - Intronic
1005178569 6:23076544-23076566 GTACAAAGTTACAGTTAAATAGG + Intergenic
1005411988 6:25559179-25559201 GTACAAACTCATAGCTAATTTGG + Intronic
1005413634 6:25577785-25577807 GTACAATTTCAGAGTAATGTAGG + Intronic
1007045191 6:38766409-38766431 GTACAAATTTTCAGTTATGCAGG + Intronic
1007117592 6:39354488-39354510 GTAAAAACACACAATGATGTAGG + Intronic
1008217661 6:48814803-48814825 GTATAAAGTTGCAGTTATGTAGG - Intergenic
1008457607 6:51728722-51728744 GTATTATCTCACAGTTTTGTAGG - Intronic
1008774683 6:55023451-55023473 GTACAAAGTTGCAGTTATCTAGG + Intergenic
1008778229 6:55067391-55067413 ATACAAACTTGCAGTTATGTAGG - Intergenic
1009615176 6:65995269-65995291 GTACACACTTGCAGTTATGTAGG + Intergenic
1009798338 6:68501673-68501695 GTACAAAGTTGCATTTATGTGGG + Intergenic
1009907299 6:69885584-69885606 GTACAAAATAGCAGATATGTAGG - Intronic
1010321382 6:74514174-74514196 GTACAAAGTTACAGTTAGATAGG + Intergenic
1010321433 6:74514854-74514876 GTACAAAGTTACAGTTAGATAGG + Intergenic
1010342504 6:74771438-74771460 GTACAAAGTTGCAGATATGTAGG - Intergenic
1010443384 6:75925011-75925033 GTACAAAGTTACAATTAGGTAGG + Intronic
1012419343 6:99046139-99046161 GTACAAAGTTTCAGTTATGCAGG - Intergenic
1012840859 6:104327299-104327321 CTATCAACTCACAGTTCTGTAGG + Intergenic
1012949209 6:105500108-105500130 GTTAATACTCACTGTTATGTGGG - Intergenic
1013420618 6:109963248-109963270 GTACAAAATTACAGCTAGGTGGG + Intergenic
1013627169 6:111949920-111949942 GTATTAGCTCACAGTTCTGTAGG - Intergenic
1014299429 6:119662530-119662552 GTACTAGCTCACAGTTCTGTAGG - Intergenic
1014375219 6:120663988-120664010 GTACAAAGTTTCAGTTAGGTAGG - Intergenic
1014418265 6:121210914-121210936 TTATTAACTCACAGTTTTGTAGG - Intronic
1016657796 6:146542179-146542201 GTACAAAGTTGCAGTTATATAGG - Intergenic
1016840657 6:148521170-148521192 GTGCAAACTAAAAGTTAGGTGGG - Intronic
1017078685 6:150645082-150645104 CTACAAAATCATAGTTATTTAGG + Intronic
1017629885 6:156386448-156386470 GTACAAAGTCTCAGCTATGGGGG + Intergenic
1017801479 6:157900045-157900067 GTACAAAGTTGCAGTCATGTAGG - Intronic
1017996631 6:159537330-159537352 GTACAAAGCTGCAGTTATGTGGG + Intergenic
1020579912 7:9984070-9984092 ATACAAAGTTACAGTTAGGTAGG - Intergenic
1020612254 7:10413707-10413729 GTACAAAGTTATAGTTAGGTAGG - Intergenic
1020688443 7:11325267-11325289 ATACAAATTCACAGTTACTTTGG - Intergenic
1021020262 7:15589031-15589053 GTACAGACCCACATTTAAGTGGG + Intergenic
1023347059 7:39281403-39281425 GTACAAAGTTACAGTTAGATAGG - Intronic
1023514981 7:40992911-40992933 GGACACAGACACAGTTATGTGGG + Intergenic
1023624547 7:42103011-42103033 GTACTAACTCACACTTTTGGAGG + Intronic
1023635251 7:42203341-42203363 ATACAAAATTACAGTTAGGTAGG - Intronic
1023658646 7:42451299-42451321 GTACTCTCTCACAGTTATATGGG - Intergenic
1023808963 7:43896474-43896496 ATACAAAATTACAGTTAGGTAGG + Intronic
1024652733 7:51419875-51419897 GTATAAAGTAACAGTTAAGTGGG - Intergenic
1025037912 7:55610528-55610550 GTATAAAGTAACAGTTATGTGGG - Intergenic
1026260466 7:68750835-68750857 GTACAAGGTTGCAGTTATGTAGG - Intergenic
1026387159 7:69861436-69861458 GTACCATCTCACAGTTATAAAGG + Intronic
1027401791 7:77816671-77816693 TTACAAAATCACAGTTAGATAGG - Intronic
1027987006 7:85305997-85306019 CTTCAAACTTAGAGTTATGTAGG + Intergenic
1028042336 7:86069820-86069842 GAACAAAATCTCAGTTACGTAGG - Intergenic
1028533639 7:91866219-91866241 TTACCAAATCACAGTTAAGTGGG + Intronic
1028668528 7:93373784-93373806 GTACAAAATTACAGTTAGATAGG + Intergenic
1029964890 7:104729474-104729496 GTACAAAGTTACAGTTAGATAGG - Intronic
1030015073 7:105211085-105211107 TTATTAACTCACAGTTTTGTAGG - Intronic
1030474815 7:110017723-110017745 GTACAGACTTGCAGTTATGTAGG + Intergenic
1030593967 7:111514064-111514086 ATACAAAGTTTCAGTTATGTAGG + Intronic
1030821681 7:114099806-114099828 ATACAAAGTCACAGATACGTAGG + Intronic
1031263270 7:119549680-119549702 TTAAAAACTAGCAGTTATGTAGG + Intergenic
1031795051 7:126162642-126162664 ATACAAAATTACAGCTATGTAGG + Intergenic
1033873454 7:145785423-145785445 GTATTTACTCACAGTTCTGTGGG - Intergenic
1034841821 7:154405018-154405040 GTACACACACATATTTATGTAGG - Intronic
1035090984 7:156310107-156310129 GTACAAAGTTTCAGTTATGCAGG - Intergenic
1035147830 7:156838326-156838348 GTACAAAATTTCAGTTAGGTAGG - Intronic
1036237983 8:7058351-7058373 GTACAAAGTTTCAGTTATGCTGG - Intergenic
1037138902 8:15496353-15496375 GCACAAATTCACAGTTAGGATGG - Intronic
1038289083 8:26232662-26232684 GTACAAACGTACAGTTAAATAGG - Intergenic
1038624175 8:29174215-29174237 GAACAAACTTGCAGTTATATAGG - Intronic
1040710307 8:50180305-50180327 GTACAAACTTGAAGTTATATAGG + Intronic
1041813877 8:61944187-61944209 GTATTGACTCACAGTTTTGTAGG - Intergenic
1041864510 8:62554793-62554815 GTTCAAAGTGGCAGTTATGTAGG - Intronic
1042949932 8:74190571-74190593 GTACAAAGTTACAGTTAGATAGG - Intergenic
1044259643 8:90102902-90102924 GTCCAAAGTTACAGTTATGTTGG - Intergenic
1044338200 8:91014624-91014646 GTACAAAGTCTCAGTTAGGCAGG + Intronic
1044741378 8:95330446-95330468 GTGCAAAGTTGCAGTTATGTAGG - Intergenic
1044797089 8:95913078-95913100 GTACAAACATGTAGTTATGTAGG + Intergenic
1046660870 8:116947226-116947248 TTCCAACCTCACAGTTTTGTTGG - Intergenic
1046778005 8:118184382-118184404 GTACATACACACAGTGATGGAGG - Intergenic
1048047684 8:130788518-130788540 GTACAAACTTACAGTTAGATAGG + Intronic
1048113269 8:131491109-131491131 GTAAAAACTCACTGTCATATTGG - Intergenic
1048894267 8:138975522-138975544 ACAGAAGCTCACAGTTATGTTGG - Intergenic
1049161009 8:141097611-141097633 GTACAAACATACAGTTAGATAGG - Intergenic
1050005159 9:1121834-1121856 GTACAAAATTATAGTTAGGTAGG - Intergenic
1051519898 9:17974476-17974498 GTACAAAGTTTCAGTTACGTAGG - Intergenic
1051864938 9:21669460-21669482 GTACAAAATTTCAGTTATATTGG - Intergenic
1052051351 9:23851861-23851883 GTACAGCATCACAGTTAAGTTGG - Intergenic
1052138169 9:24941824-24941846 GTGCAAACTGAACGTTATGTCGG - Intergenic
1052461305 9:28767121-28767143 GTACAAACTTTCAGTTATGTAGG + Intergenic
1052495965 9:29224544-29224566 GTACAAAATTTCAGTTACGTAGG + Intergenic
1053563339 9:39219902-39219924 ATACAAAATTTCAGTTATGTAGG - Intronic
1053829127 9:42057823-42057845 ATACAAAATTTCAGTTATGTAGG - Intronic
1054133808 9:61399164-61399186 ATACAAAATTTCAGTTATGTAGG + Intergenic
1054601433 9:67129624-67129646 ATACAAAATTTCAGTTATGTAGG + Intergenic
1054941052 9:70742528-70742550 ATACAAAATCACAGTTAGGTAGG - Intronic
1055398603 9:75899491-75899513 GTACAAACTCACAGTTATGTAGG - Intronic
1055426656 9:76203677-76203699 TCACTAACTCACAGTTCTGTAGG - Intronic
1055460197 9:76512231-76512253 GTACAAACTTTCAGTTATAAGGG - Intergenic
1055501763 9:76908538-76908560 GTATTACCTTACAGTTATGTAGG + Intergenic
1055879172 9:80978228-80978250 GTACAAAATTACAGTTAGGTAGG - Intergenic
1055976608 9:81961619-81961641 GTACAAAATTGTAGTTATGTAGG - Intergenic
1055987823 9:82070066-82070088 GTACAAAGCAACAGTTATGCAGG - Intergenic
1056735232 9:89203802-89203824 GTACAAAGTTGCAGTTATGTAGG + Intergenic
1056857389 9:90144440-90144462 ATACAAAGTAACAGATATGTAGG - Intergenic
1057748482 9:97771312-97771334 GAACAAACTGACAGTTAAGCAGG + Intergenic
1058241910 9:102573309-102573331 GTACAAAGTTACAGTTAGATAGG + Intergenic
1058657630 9:107238261-107238283 GTATTAGCTCACAGTTCTGTAGG + Intergenic
1058920977 9:109614634-109614656 GTACAAACTTGCAGTTATGTAGG + Intergenic
1060327929 9:122635401-122635423 ATACAAAGTTACAGTTTTGTAGG + Intergenic
1061511608 9:131064686-131064708 GTACATACTCATTGTAATGTTGG + Intronic
1187071216 X:15890452-15890474 GTACACAGTTACAGTTATGTAGG + Intergenic
1187183155 X:16962547-16962569 GTACAAACTTGCAGTGATGTAGG + Intronic
1188013960 X:25087378-25087400 GCACAAACTTGCAGTTATATAGG - Intergenic
1188722318 X:33538233-33538255 GAACAAACTTGCAGTTATATAGG + Intergenic
1188815771 X:34712040-34712062 GTATAAATTTTCAGTTATGTGGG + Intergenic
1188976205 X:36678922-36678944 GTACAAAGTTGCAGTTATGTGGG + Intergenic
1189081182 X:37974080-37974102 GTACAAAGTTGCAGTTATATAGG + Intronic
1189147386 X:38668992-38669014 GTACAAAGTCACAGCTAGATAGG + Intronic
1189844562 X:45121907-45121929 GTACAAAGTTTCAGTTAGGTAGG + Intergenic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1190507189 X:51137782-51137804 CTACAAACTCTTTGTTATGTTGG - Intergenic
1190574602 X:51820859-51820881 GTACAAAATTACAGTTAAATAGG - Intronic
1190961478 X:55253640-55253662 GTATGAAGTCACAGCTATGTGGG + Intronic
1193501778 X:82285137-82285159 GTATAAACTTGCAGTTATGTAGG + Intergenic
1193664121 X:84295262-84295284 ATACAAAATTACAGTTATATAGG - Intergenic
1193847049 X:86485412-86485434 GTACAAACCTACAGTTAGATAGG + Intronic
1194234377 X:91364132-91364154 GTACAAACATACAGTTAGATAGG - Intergenic
1194440369 X:93925568-93925590 TTAAAACCTCACAGTTTTGTGGG + Intergenic
1194519863 X:94905901-94905923 GTCCCAACTCCCACTTATGTGGG + Intergenic
1194989007 X:100524872-100524894 GTACAAACTTGAAGTTATGTAGG - Intergenic
1195400904 X:104459942-104459964 GTACAAACATACAGTTCTGTAGG + Intergenic
1195444143 X:104931916-104931938 ACACAGACTCACAGATATGTGGG + Intronic
1195602170 X:106762212-106762234 GTACAAACTTACAGTTAGGCAGG - Intronic
1195612209 X:106880576-106880598 GTACAAAGTTACAGTTAGATAGG + Intronic
1196051123 X:111305511-111305533 ATACAAAATAACAGATATGTAGG - Intronic
1196320313 X:114280209-114280231 GAACAAAGTCACAGTTAGGCAGG - Intergenic
1196744825 X:119061991-119062013 GAACAAAGTTTCAGTTATGTAGG + Intergenic
1197424396 X:126277400-126277422 GTATAAAGTTACAGTTATGCAGG + Intergenic
1197862553 X:130985832-130985854 GCACAAAGTTGCAGTTATGTAGG - Intergenic
1198511841 X:137360157-137360179 GTACAAACTTTCAGTTATGCAGG - Intergenic
1199016121 X:142818249-142818271 GTACAAAGTCGCAGTGATGCAGG + Intergenic
1199066087 X:143420083-143420105 GTACAAAGTTACAATTATGTAGG - Intergenic
1199386745 X:147231864-147231886 GTACAGAGTCACAGTTAGGAGGG + Intergenic
1199406358 X:147466071-147466093 GGACAAAGTTACAGTTAGGTAGG + Intergenic
1199528830 X:148824314-148824336 GTACAAACTTTCAGTTATGTAGG + Intronic
1199554770 X:149094597-149094619 ATACAAAATTACAGTTAGGTAGG + Intergenic
1201984927 Y:19955497-19955519 GCACAAAGTTATAGTTATGTAGG - Intergenic