ID: 1055399910

View in Genome Browser
Species Human (GRCh38)
Location 9:75912247-75912269
Sequence AACCAGAACGTGCTTCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 94}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055399910_1055399916 10 Left 1055399910 9:75912247-75912269 CCTGGAGGAAGCACGTTCTGGTT 0: 1
1: 0
2: 1
3: 7
4: 94
Right 1055399916 9:75912280-75912302 CCAGTGCAAAGGCCGTGGACAGG No data
1055399910_1055399918 30 Left 1055399910 9:75912247-75912269 CCTGGAGGAAGCACGTTCTGGTT 0: 1
1: 0
2: 1
3: 7
4: 94
Right 1055399918 9:75912300-75912322 AGGAGAGAACCCTACTATGTTGG No data
1055399910_1055399914 5 Left 1055399910 9:75912247-75912269 CCTGGAGGAAGCACGTTCTGGTT 0: 1
1: 0
2: 1
3: 7
4: 94
Right 1055399914 9:75912275-75912297 AACAGCCAGTGCAAAGGCCGTGG No data
1055399910_1055399913 -1 Left 1055399910 9:75912247-75912269 CCTGGAGGAAGCACGTTCTGGTT 0: 1
1: 0
2: 1
3: 7
4: 94
Right 1055399913 9:75912269-75912291 TGAGGGAACAGCCAGTGCAAAGG 0: 6
1: 47
2: 244
3: 740
4: 1867

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055399910 Original CRISPR AACCAGAACGTGCTTCCTCC AGG (reversed) Intronic
901188292 1:7388930-7388952 CACCAGACCGAGCTTCCTGCCGG + Intronic
901868541 1:12123801-12123823 ATCCAGAACGGGCTTCCCCGTGG - Exonic
902090757 1:13901360-13901382 AACCTTAAACTGCTTCCTCCGGG - Intergenic
907468053 1:54652648-54652670 GACCACAACCTGCTCCCTCCTGG - Intronic
907476543 1:54709755-54709777 AATCAAAACCTGCCTCCTCCAGG - Intronic
909347623 1:74610637-74610659 AACCACTACATTCTTCCTCCTGG + Intronic
919918946 1:202156870-202156892 AAATAGAAGGTGCTTGCTCCGGG + Intronic
919945434 1:202315821-202315843 AAGCAGCACCTGCTTCCTCCAGG - Intronic
921065852 1:211621432-211621454 AAGCGGAACTGGCTTCCTCCAGG - Intergenic
1063179406 10:3584294-3584316 CACCAGAACTTGCATCCTGCAGG + Intergenic
1065791756 10:29266808-29266830 AACCAGAGCGGGCTCCCTGCTGG - Intergenic
1068484350 10:57637711-57637733 TCTCAGAACTTGCTTCCTCCTGG - Intergenic
1071490566 10:86133768-86133790 AACTAGAACGTGCTGCCTGTAGG - Intronic
1076509642 10:131003589-131003611 AAGCAGAACACGCTGCCTCCAGG - Intergenic
1077150706 11:1071877-1071899 GAGCAGGACGTGCTGCCTCCAGG - Intergenic
1078030492 11:7746313-7746335 AACCACAGAGTGCTTCCTGCTGG + Intergenic
1078055606 11:8006646-8006668 AAGCAGAAGGTGCTTTCTCTGGG - Intergenic
1079071857 11:17353732-17353754 AGCCGGAACTAGCTTCCTCCAGG - Intronic
1081637114 11:44728038-44728060 AGCCAGAACGCGCTTCCTGCTGG - Intronic
1082822064 11:57550808-57550830 AACCAGAAAGTTCTTCTTCTGGG + Intergenic
1082943738 11:58735834-58735856 AACCAGAAAGTGCCTCCCCTTGG - Intergenic
1090202333 11:124865698-124865720 AACCACACCCTGCTGCCTCCCGG + Exonic
1091139157 11:133220563-133220585 AGCCAGCACATGCTTCCTCAAGG + Intronic
1091332547 11:134741588-134741610 AACCACAACGTGATGCCACCCGG - Intergenic
1091565721 12:1646542-1646564 AACCACAACCTCCCTCCTCCAGG - Exonic
1096362527 12:51000550-51000572 TACCAGAACGTGCCTCCACTTGG + Intronic
1096455805 12:51784865-51784887 ATTCAGAACCTACTTCCTCCAGG - Intronic
1096496674 12:52042924-52042946 AGCCAGTGCGTGCTTCATCCGGG - Intronic
1106761837 13:32875427-32875449 AACCAGAACTTCCTTCCTAAGGG - Intergenic
1113096112 13:106665698-106665720 AACCAGAACATTCTTCCCCAAGG + Intergenic
1113451897 13:110416286-110416308 CTCCAGAATCTGCTTCCTCCTGG + Intronic
1113801390 13:113088263-113088285 AACCAAAGCGTGTTTCCTCGGGG + Intronic
1115903200 14:38177409-38177431 AACCAGAATGAACTTCCTGCTGG - Intergenic
1119001583 14:70886809-70886831 AACCAGAATGAGCTTCCACAAGG - Intergenic
1120474623 14:84971569-84971591 AACCAGAACCTGATTTCTGCGGG - Intergenic
1120933163 14:89868614-89868636 AGCCAGAACTGGCCTCCTCCAGG - Intronic
1122308394 14:100779716-100779738 CACCAGAACGTCCCTCCCCCCGG + Intergenic
1125233260 15:37482775-37482797 CTCCAGAAGGTGCTTCCTCTTGG + Intergenic
1129960327 15:79678928-79678950 AACCAAAGCATGCTTCCTACAGG + Intergenic
1130199123 15:81808848-81808870 CACCAGAACTTGCATCCTCAGGG - Intergenic
1139752451 16:69117874-69117896 AACCAAAGCTTGCTTCCTCTTGG + Intronic
1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG + Intronic
1147951384 17:44109868-44109890 CACCACAAGATGCTTCCTCCAGG - Intronic
1148177745 17:45582564-45582586 AACCAGAAAAAACTTCCTCCAGG + Intergenic
1150747636 17:67828335-67828357 AACCAGAAAAAACTTCCTCCAGG - Intronic
1152523389 17:80873407-80873429 AACCAGGACGTGCTGCCTCCTGG + Intronic
1154390643 18:13933541-13933563 ACCCAGCATGTGCTTCCTCTTGG - Intergenic
1159916661 18:74194126-74194148 TACCAGCAGCTGCTTCCTCCAGG + Intergenic
1161470429 19:4454288-4454310 AACCAGCATCTCCTTCCTCCAGG - Intronic
1164615067 19:29662874-29662896 GACCAGTGCGTGCTGCCTCCAGG + Intergenic
1165299715 19:34961089-34961111 AACCAGGGCCTGCTACCTCCTGG - Intronic
1165723947 19:38099792-38099814 AACTTGAACCTGCTGCCTCCTGG - Intronic
925242661 2:2345958-2345980 AAACATGACGTGCTTCCTCATGG - Intergenic
931703047 2:64924401-64924423 TACCAGAACAAGCTACCTCCAGG - Intergenic
932313186 2:70760632-70760654 AACCACACCCTGCTTCCCCCTGG - Intronic
934132140 2:88958456-88958478 ACCCAGATTCTGCTTCCTCCAGG + Intergenic
936688948 2:114863251-114863273 AGCCAGAATCTGATTCCTCCTGG + Intronic
939646248 2:144702576-144702598 AACCAGATCATGCTTGCCCCTGG + Intergenic
944891002 2:204117403-204117425 AACTAGAATGGGCTTCCTCACGG - Intergenic
949008697 2:241666284-241666306 AGCCAGAACCCGCTCCCTCCGGG - Intronic
1169719931 20:8665085-8665107 AACCAGGATGTGCTTCCTAAAGG + Intronic
1170986820 20:21266423-21266445 AACCAGCTGGTGTTTCCTCCAGG - Intergenic
1173980967 20:47223854-47223876 AACTAGATAGTGCTTCCTGCTGG + Intronic
1181386602 22:22550532-22550554 AACATGCACCTGCTTCCTCCTGG - Intronic
1184459483 22:44628849-44628871 AAACAGGACGTGCTTCCACAGGG + Intergenic
1185074851 22:48677668-48677690 AACCAGGAGCTGCTTCCTCTGGG - Intronic
949529774 3:4944112-4944134 AACCAGAAAGTGGTTGCTTCTGG - Intergenic
951508887 3:23479909-23479931 AACCAGATGGTGCTTTCTCCAGG - Intronic
951541428 3:23785921-23785943 GAGCAGAACTTGCTTCCTCTTGG - Intergenic
951638961 3:24812430-24812452 ACCCAGAACCAGCTTCCACCTGG - Intergenic
952204381 3:31165338-31165360 AACCAGAAATTACTTCTTCCTGG + Intergenic
952918527 3:38267742-38267764 GCCCAGAATTTGCTTCCTCCTGG + Intronic
953018190 3:39097995-39098017 GACCAGACCCTGCTGCCTCCTGG + Exonic
958153321 3:89720170-89720192 AACAAGTATGTGCTTCCTTCAGG + Intergenic
969117944 4:4885381-4885403 AACAAGAAAGTGAGTCCTCCAGG - Intergenic
990695942 5:58417269-58417291 AACCAAAATGTGCTGCCTGCTGG + Intergenic
996815810 5:127571356-127571378 AACCAGAAAGTTATTCCTCTGGG - Intergenic
998827735 5:146121408-146121430 AAACAGAATGTCCTTCCTCAAGG + Intronic
1002715104 5:181222385-181222407 GACCAAAACGTGTTTCCGCCCGG + Intergenic
1003827128 6:9965514-9965536 AATCAGAAGGTACTTCCTTCAGG - Intronic
1010145795 6:72668530-72668552 AACTAGAACTTGATTACTCCAGG + Intronic
1010145798 6:72668556-72668578 AACCAGAACTTGGTTACTCCAGG + Intronic
1014421992 6:121257799-121257821 AACCAGAAGGGGCCTCCTACTGG - Intronic
1018831286 6:167445582-167445604 CACCAGAACTTGATTCCTGCAGG + Intergenic
1023859721 7:44211131-44211153 ACCCAGCACCTGCTGCCTCCTGG + Intronic
1025813607 7:64890169-64890191 ACCCCTAACCTGCTTCCTCCAGG - Intronic
1034369326 7:150580840-150580862 AACCTGAATGTACTTCCTCTTGG - Intergenic
1034947560 7:155273133-155273155 GACCAGAACGTGCACCATCCAGG - Intergenic
1045189771 8:99871255-99871277 TAACAGAACCTGCTTCCTCCTGG - Intronic
1049103806 8:140598641-140598663 AGCCAGCACGCGCTTCCTCCTGG - Intronic
1049521582 8:143094229-143094251 AACCAGCACGAGCTGCATCCAGG - Intergenic
1055399910 9:75912247-75912269 AACCAGAACGTGCTTCCTCCAGG - Intronic
1055594628 9:77852490-77852512 AAACAGGGTGTGCTTCCTCCTGG + Intronic
1057786254 9:98089574-98089596 AACCAGAACTTTCTCCCACCAGG + Intronic
1059563324 9:115356644-115356666 GCCAAGAACGAGCTTCCTCCTGG + Intronic
1060470080 9:123941195-123941217 AACCAGAACATGGTACCTGCTGG - Intergenic
1061674545 9:132208359-132208381 AACCAAAACCAACTTCCTCCCGG - Intronic
1186142747 X:6594054-6594076 GACCAGAACGTGCTACTTCCAGG + Intergenic
1187276386 X:17819792-17819814 AATCAGAAAGTGGTTGCTCCAGG + Intronic
1189547105 X:42052897-42052919 AACCTGAACATGCTTCCTGAAGG + Intergenic
1198049878 X:132940826-132940848 AACCAGAAAGTACTGCATCCTGG + Intronic
1200210328 X:154344265-154344287 GACCAGAACGGGCTTCCCACCGG - Intergenic
1200220524 X:154387827-154387849 GACCAGAACGGGCTTCCCACCGG + Intergenic