ID: 1055400178

View in Genome Browser
Species Human (GRCh38)
Location 9:75915087-75915109
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055400171_1055400178 11 Left 1055400171 9:75915053-75915075 CCCATCTTGTTTTGTCCGTTGGA 0: 1
1: 1
2: 0
3: 9
4: 86
Right 1055400178 9:75915087-75915109 CTTTCCTAGGGGAAGTTAGAAGG No data
1055400173_1055400178 -4 Left 1055400173 9:75915068-75915090 CCGTTGGAACCACAGAACTCTTT 0: 1
1: 0
2: 0
3: 24
4: 265
Right 1055400178 9:75915087-75915109 CTTTCCTAGGGGAAGTTAGAAGG No data
1055400172_1055400178 10 Left 1055400172 9:75915054-75915076 CCATCTTGTTTTGTCCGTTGGAA 0: 1
1: 0
2: 0
3: 11
4: 184
Right 1055400178 9:75915087-75915109 CTTTCCTAGGGGAAGTTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr