ID: 1055401525

View in Genome Browser
Species Human (GRCh38)
Location 9:75929559-75929581
Sequence CCTCCCCTACTGCAGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 274}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055401525_1055401535 23 Left 1055401525 9:75929559-75929581 CCCTCCAGCTGCAGTAGGGGAGG 0: 1
1: 0
2: 0
3: 36
4: 274
Right 1055401535 9:75929605-75929627 AGCTTGACACAGTCAAGGAATGG No data
1055401525_1055401536 27 Left 1055401525 9:75929559-75929581 CCCTCCAGCTGCAGTAGGGGAGG 0: 1
1: 0
2: 0
3: 36
4: 274
Right 1055401536 9:75929609-75929631 TGACACAGTCAAGGAATGGAAGG No data
1055401525_1055401531 -8 Left 1055401525 9:75929559-75929581 CCCTCCAGCTGCAGTAGGGGAGG 0: 1
1: 0
2: 0
3: 36
4: 274
Right 1055401531 9:75929574-75929596 AGGGGAGGTGCCGCAGGTGGAGG No data
1055401525_1055401534 18 Left 1055401525 9:75929559-75929581 CCCTCCAGCTGCAGTAGGGGAGG 0: 1
1: 0
2: 0
3: 36
4: 274
Right 1055401534 9:75929600-75929622 CAATGAGCTTGACACAGTCAAGG No data
1055401525_1055401532 -7 Left 1055401525 9:75929559-75929581 CCCTCCAGCTGCAGTAGGGGAGG 0: 1
1: 0
2: 0
3: 36
4: 274
Right 1055401532 9:75929575-75929597 GGGGAGGTGCCGCAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055401525 Original CRISPR CCTCCCCTACTGCAGCTGGA GGG (reversed) Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
900182739 1:1319475-1319497 ACTCCCCTACTTCAGCGAGATGG - Exonic
900629873 1:3628708-3628730 GCTGCCCTGCTGCTGCTGGAAGG + Exonic
900660119 1:3777966-3777988 CCTCCCCTGCTGGGGCTGGCAGG - Intergenic
901474221 1:9478527-9478549 CCTCCTCTCCTCCATCTGGAAGG + Intergenic
901528052 1:9836342-9836364 GCTTGCCTCCTGCAGCTGGAAGG - Intergenic
902282096 1:15382177-15382199 CCTCACCTTCTGCTGCCGGATGG - Exonic
902535924 1:17119333-17119355 GCTCCCGTACTGCAGCCGCACGG + Exonic
902620595 1:17648537-17648559 CCTCCCCTACAGCAAGAGGAAGG - Exonic
903063769 1:20687105-20687127 GCTCCCGTTCTGCAGATGGAGGG - Intronic
904329075 1:29746209-29746231 CTGCCCCTTCTGCAGCTGGAAGG + Intergenic
905352402 1:37356706-37356728 CCTCACCTGCAGCAGCTGGGGGG - Intergenic
907023628 1:51094160-51094182 CATCCCCTACAGCAGCTATATGG + Intergenic
908618536 1:65950029-65950051 CTTCCACTTCTGCACCTGGATGG - Intronic
908766856 1:67562029-67562051 CATCTCTTACTGCAGCAGGAAGG - Intergenic
909026480 1:70487479-70487501 TTTCCCTGACTGCAGCTGGAGGG - Intergenic
915111346 1:153566321-153566343 CCTCCTCTTCTCCAGCTTGAGGG + Intronic
915254403 1:154615092-154615114 TCTCCCCTACAGCCTCTGGAGGG + Intronic
915475658 1:156151321-156151343 TCTCCCCTGCTTCAGCTGGCAGG - Intronic
915742702 1:158131427-158131449 CCTCCCCTATAGCCTCTGGAGGG + Intergenic
918007339 1:180554268-180554290 CCTCCCCTACAGCATTTGGAGGG + Intergenic
918516328 1:185367439-185367461 TCTCCCCTACAGCATGTGGAAGG + Intergenic
919572341 1:199264415-199264437 CCTCCCCTCTTGCATCTTGATGG + Intergenic
920631575 1:207658473-207658495 CCTGCACTCCTGCAGCTGGCAGG + Intronic
920642061 1:207762603-207762625 CCTGCCCTCCTGCAGCCGGCAGG + Intronic
921851494 1:219936709-219936731 CCTCTCCTATTGCAGTTTGAAGG - Intronic
922228637 1:223666924-223666946 TCTCCCCTAGAGCCGCTGGAGGG + Intergenic
922362846 1:224838887-224838909 CCTCCCCTACTACAGTTGGTTGG + Intergenic
923332204 1:232935492-232935514 CCTTCCCAACTGCAGCTTGATGG + Intergenic
924534311 1:244921155-244921177 ACTCCACCACTGCAGCTGGCAGG - Intergenic
1062860795 10:807657-807679 CCTGCCCTGGTGGAGCTGGAGGG - Exonic
1063698962 10:8366189-8366211 ACGCCTCTACTGCAGCTGGAAGG - Intergenic
1064006829 10:11705430-11705452 CCTAGCCTGCCGCAGCTGGAGGG + Intergenic
1065948110 10:30625859-30625881 CCTCCCCTAAAGCAGGGGGATGG - Intronic
1066534583 10:36377214-36377236 TGTACCCTACTGCTGCTGGATGG + Intergenic
1067432548 10:46253507-46253529 CCTCCCCTTCAGCAGCAGGAGGG + Intergenic
1067432551 10:46253511-46253533 CGTCCCCTCCTGCTGCTGAAGGG - Intergenic
1067440711 10:46307940-46307962 CCTCCCCTTCAGCAGCAGGAGGG - Intronic
1068629396 10:59284395-59284417 CCACCCCTGCTGGAGCTGGGAGG - Intronic
1070310582 10:75270756-75270778 TCTCCCCTAAAGCCGCTGGAAGG - Intergenic
1070628132 10:78065842-78065864 CCTCCCCCTCTGCAGGTGGCTGG - Intergenic
1071336418 10:84604113-84604135 CCTCCCCCACTGCACCTGAAGGG - Intergenic
1072427194 10:95339444-95339466 CCTTCCCTGCTGAACCTGGAGGG + Intronic
1074112317 10:110431244-110431266 CCTCCTCTACTGCTGGTGGGAGG - Intergenic
1074248132 10:111714528-111714550 TCTCACCTGCTGCAGCTGTAGGG - Intergenic
1074613007 10:115039242-115039264 CCTCCCCCGCTACAGCTTGAAGG - Intergenic
1075025074 10:118978399-118978421 AGTCACCTGCTGCAGCTGGAAGG - Intergenic
1075467011 10:122659036-122659058 CCTCCACTCATGAAGCTGGAAGG + Intergenic
1076338660 10:129727957-129727979 CCTCCCCTGCTCCAGCCAGAAGG - Intronic
1076904360 10:133354869-133354891 CCTGCCCTCCTGCGGGTGGAAGG + Intergenic
1077167961 11:1152247-1152269 CCTCTCCTGATGCTGCTGGAGGG + Intergenic
1077250813 11:1559841-1559863 CCTGCCCTGCACCAGCTGGAAGG + Intronic
1077497089 11:2891616-2891638 CCTCCTCCACTGCAGGAGGAGGG + Intronic
1077863666 11:6205388-6205410 CTTCCCCTAATGCAGGAGGATGG + Intergenic
1079141345 11:17812059-17812081 CTGCCCCTTCTGCAGATGGAGGG - Intronic
1081091131 11:38867441-38867463 CATCCCCTAGAGCAGCTGCAGGG - Intergenic
1081549799 11:44100651-44100673 CCGCATCTCCTGCAGCTGGAGGG + Intronic
1082925970 11:58547645-58547667 CCTCGCCTCCTGCAGCTTGAAGG + Intronic
1083022919 11:59525394-59525416 CCTCCCCACCTGCATTTGGATGG + Intergenic
1084150496 11:67285862-67285884 CCTGCCCCTCTGCAGCAGGAGGG - Exonic
1084582166 11:70030823-70030845 CCACCCCTCCACCAGCTGGAAGG + Intergenic
1084973385 11:72783332-72783354 CCTCCCACACTGCAGATGGAAGG - Intronic
1085477607 11:76797890-76797912 CCTCCCCTACCCCTGCTGGCCGG + Exonic
1088040504 11:105375607-105375629 CCTCCGCTAGTGCAGCATGAAGG - Intergenic
1088649408 11:111944146-111944168 CCTCATCTTCTGCTGCTGGAGGG + Intronic
1088847718 11:113682001-113682023 CCGCCCGTACGGGAGCTGGATGG - Intergenic
1089058304 11:115605926-115605948 CCTCTCCTTCTGCAGATTGATGG - Intergenic
1089326886 11:117663541-117663563 CCTCTCCCACTGCCACTGGAAGG + Intronic
1089416425 11:118296010-118296032 CCTCATCTCCTGCAGCTAGAGGG + Intergenic
1090334049 11:125950996-125951018 CCTGCCCAACTGCAGTGGGAAGG + Intergenic
1093533389 12:20194357-20194379 TCTCCCCTACAGCCTCTGGAGGG - Intergenic
1093905791 12:24690642-24690664 CCTCTCCCATTGCACCTGGAGGG - Intergenic
1095672471 12:44876653-44876675 CCTTGCCTCCTGCAGCTGGGTGG - Exonic
1095830955 12:46586056-46586078 CCTGCCTTGCTGCAGCTGGATGG - Intergenic
1101853703 12:108424790-108424812 CCTCATCTTCTGTAGCTGGAAGG - Intergenic
1105296881 13:19095496-19095518 TCTCCTCTCCTGCAGCAGGAGGG + Intergenic
1106026470 13:25960248-25960270 CATCCTCTGCTCCAGCTGGACGG - Intronic
1106316237 13:28596490-28596512 CCTTCCCTACTGCAGCTCTGCGG + Intergenic
1107173899 13:37377765-37377787 CTTACCCTACTACAGCTGCATGG - Intergenic
1107522983 13:41201685-41201707 CCTCCCCTACCTCAGTTGGAGGG + Intergenic
1112152628 13:96780691-96780713 CCTCCTCAACAGCAGCTAGAAGG - Intronic
1112458748 13:99584582-99584604 CCTGCAATACTGCAGCTGGTGGG - Intergenic
1113064520 13:106359909-106359931 CCTACCCTACAGCAGCTTGTGGG - Intergenic
1113229455 13:108195945-108195967 CCTGCCGCACTGCAGCTGAAAGG + Intergenic
1114484500 14:23054887-23054909 CCTTCCCTGCTGCTGCTGAATGG - Intronic
1118259504 14:64234304-64234326 CCTCCCCTCCTCCAGCTCCAGGG + Intronic
1119678653 14:76575431-76575453 CCTCCCCTAGAGCTTCTGGAGGG - Intergenic
1121848440 14:97196435-97196457 CATCCCCCACAGCAGCTGCAAGG - Intergenic
1122305798 14:100765674-100765696 TCTCATCTCCTGCAGCTGGAGGG - Intergenic
1124851345 15:33341606-33341628 CCTCCCCTCCTGCTTCTAGATGG - Intronic
1128291204 15:66479760-66479782 CCTGCCCTCCTGCAGCTGATTGG + Intronic
1128648429 15:69393624-69393646 CCTGCCCAACTGCAGCCGGATGG - Intronic
1128694885 15:69754022-69754044 CCTCACCCACTGCAGCTCCAAGG + Intergenic
1132577697 16:671539-671561 CCTCCCCTATCGCAGCTGCAAGG + Intronic
1132930959 16:2459095-2459117 CCTCCCCCACCGCTGATGGAGGG + Intergenic
1133287859 16:4698794-4698816 ACTCACCTTGTGCAGCTGGATGG + Exonic
1134037927 16:11045928-11045950 TGTCCACTGCTGCAGCTGGATGG - Intronic
1134848558 16:17461494-17461516 CCTCCACTCCTGCAGTTAGAAGG - Intronic
1135912231 16:26571930-26571952 CCTACCCTAGTGTACCTGGAAGG - Intergenic
1136132148 16:28229759-28229781 TAGCCCCTCCTGCAGCTGGATGG - Intergenic
1139453418 16:67050882-67050904 ACTGCCATACTGCAGCAGGATGG + Intronic
1141587792 16:85046545-85046567 CCTTCCCTTCTACAGATGGACGG + Intronic
1141773890 16:86109498-86109520 CCTCCCCTACAGCCTCTGGAGGG + Intergenic
1142883200 17:2896787-2896809 CCTCATCTAATGCACCTGGAGGG + Intronic
1143662735 17:8336749-8336771 TCTCCCCTCCAGCAGCTGGAGGG + Intergenic
1144366043 17:14545799-14545821 CCTCACCTACTGCAGATGGGAGG + Intergenic
1144676552 17:17165922-17165944 CCTCTCCTGCTCCAGCTGGGAGG - Intronic
1144957077 17:19024148-19024170 TCTCCCCTGCTGCAGATGGCAGG + Intronic
1145231131 17:21174080-21174102 CCTGCCCTACTTTATCTGGATGG - Intronic
1146234601 17:31146540-31146562 TCTCCTCTCCTGCAGCAGGAGGG - Intronic
1146247704 17:31304564-31304586 CCTCCCCTTCTGGATTTGGAAGG - Exonic
1146885095 17:36465098-36465120 CCTGCCCTCCCGCAGCTGGAAGG - Intergenic
1147419044 17:40312923-40312945 CCTTCCCTACTGCAGCAAGGAGG + Intronic
1147999050 17:44377008-44377030 CCTCCGTATCTGCAGCTGGAAGG + Exonic
1148462790 17:47847889-47847911 GCTGCCCTCCGGCAGCTGGAAGG + Exonic
1148564841 17:48626679-48626701 CCCCCCTTCCTGCAGCGGGAGGG - Intronic
1148779607 17:50113937-50113959 CCGCAGCTGCTGCAGCTGGACGG - Exonic
1149544619 17:57494211-57494233 TCTCCCTTACTGCAGATGGTGGG - Intronic
1149651931 17:58281030-58281052 CCTCCCCCACTGGGGTTGGAAGG + Intergenic
1150824908 17:68465846-68465868 CATCCTCTACTGCTGCTGTAGGG - Intergenic
1151277854 17:73049405-73049427 CCTGCCCTGCTGCTCCTGGAAGG - Intronic
1151331429 17:73411507-73411529 CCTCCCCTCCCACATCTGGAGGG + Intronic
1152372911 17:79901617-79901639 CCTCCCCTAGAGCCTCTGGAGGG - Intergenic
1152570876 17:81120745-81120767 CCCCCACTGCTGCAGCTTGAAGG - Exonic
1152581972 17:81169612-81169634 CCTCCCCTGGAGCATCTGGAGGG - Intergenic
1152695405 17:81741504-81741526 CCTCCCCTTTTGCAGGAGGATGG + Intergenic
1152779252 17:82219168-82219190 CCTCCTCTTCTGCAGCTTGGGGG - Intergenic
1156482920 18:37447504-37447526 CTTCCTCTCCTGCAGCTGGAGGG + Intronic
1156499830 18:37550673-37550695 CCTCCCCTGCTGCAGCAGAGAGG - Intronic
1157006622 18:43590434-43590456 CCTCACCCACTGCCGCTGCAGGG - Intergenic
1157194053 18:45606054-45606076 CCTCCCCGCCTCCAGCTGGATGG - Intronic
1157421497 18:47551148-47551170 CCTCCCCTACTGACCCTGGCAGG - Intergenic
1157572897 18:48724616-48724638 CCTTCCCTACAGCTGCTGGGCGG + Intronic
1158180772 18:54712964-54712986 CCGCCTCTCCTGCAGGTGGATGG + Intergenic
1159386757 18:67735746-67735768 CCTCCCCAACAGCTGCTGGGAGG + Intergenic
1160030044 18:75250036-75250058 CCCCACCTACTGCAGGAGGAAGG - Intronic
1160187803 18:76688903-76688925 CCATCCCTGCTGCAGGTGGACGG - Intergenic
1160370423 18:78368446-78368468 CCTCTCCTATTGCAGATGGGAGG + Intergenic
1160784888 19:895563-895585 CCTCCCCTAGAGACGCTGGAGGG + Intergenic
1160868952 19:1268367-1268389 CCTCCCCTACTGAGCCTGGTTGG - Intronic
1160880286 19:1316552-1316574 CCCCCCCTACTGCCCCTGCAAGG + Intergenic
1161370705 19:3909384-3909406 CCTCCACTCCTGCCGCTGGCTGG - Intronic
1161454579 19:4363603-4363625 CCTCCCCTGCTGCAGCGGCCAGG + Intronic
1163452053 19:17384104-17384126 CCTCCCCTCCCATAGCTGGAGGG - Intergenic
1163755270 19:19102926-19102948 CCTCCCCTAGAGCCTCTGGAGGG - Intronic
1164672559 19:30081049-30081071 TGTCCCCTGCTGCAGCTGCATGG + Intergenic
1165008326 19:32824323-32824345 CCAGCCCTGCTGCAGCTGGTCGG + Intronic
1165475413 19:36027318-36027340 GCTCCCCTACTGAGGCTGGAAGG - Intronic
1167288926 19:48614193-48614215 CCTCCACTGCAGCAGCTGGAAGG - Intronic
1167638309 19:50667568-50667590 CGTCCCCAGCTGCAGCAGGAGGG + Exonic
1168170538 19:54585515-54585537 CCTGCGATGCTGCAGCTGGATGG - Intronic
925166821 2:1720834-1720856 CCTCCCGGACCGCAGCTGGTTGG + Intronic
925449533 2:3956969-3956991 CCTGCTCTGCAGCAGCTGGAGGG - Intergenic
928126591 2:28620700-28620722 CTTCCCCTCCTCCAGCAGGAAGG - Intronic
930091629 2:47535216-47535238 CCTCCCTGGCTGCAGCTGAAAGG - Intronic
932270328 2:70403510-70403532 CCTTTTCTTCTGCAGCTGGAAGG + Intergenic
932868706 2:75374624-75374646 CCTGTGATACTGCAGCTGGATGG - Intergenic
934613119 2:95755202-95755224 CTTCCTCCACTGCAGCTGGGGGG - Intergenic
934647779 2:96069220-96069242 CTTCCTCCACTGCAGCTGGGGGG + Intergenic
934841153 2:97625041-97625063 CTTCCTCCACTGCAGCTGGGGGG + Intergenic
934855577 2:97727383-97727405 CCTGCCCTGCTGCATCTGGAGGG + Intronic
935216650 2:100980247-100980269 CCGCCTCCACTGCAGGTGGAAGG + Intronic
936287634 2:111193056-111193078 ACTGCCCTCCTGCAGGTGGAAGG + Intergenic
936649865 2:114413724-114413746 CCTGCGATGCTGCAGCTGGATGG - Intergenic
936912126 2:117604025-117604047 CCACCCCTACTGTCTCTGGAAGG - Intergenic
937449862 2:121993059-121993081 CCTCCCATCCTCCAGCTGTAGGG + Intergenic
939096040 2:137834566-137834588 CTTCCCATGCTGCACCTGGACGG + Intergenic
940803331 2:158156851-158156873 CCTCCCATATTGAAGCTGGATGG - Intergenic
943212110 2:184980193-184980215 CCTCATCTCCTGCAGCTGCAGGG + Intergenic
945356308 2:208843569-208843591 CCTCTACTAGTGCAGGTGGAGGG + Intronic
945981810 2:216318318-216318340 CGTCCCCTACAGCAGTTGGCTGG - Intronic
947508260 2:230726804-230726826 CCTTCCCTACAGAAGCTGAAAGG + Intronic
947750739 2:232530679-232530701 CCAACCCCACTGCAGATGGAAGG - Intronic
948586542 2:239023564-239023586 CCTCCCCCACTGCACGAGGATGG + Intergenic
948610773 2:239165277-239165299 CTGCCCCTGCTGCAGGTGGATGG - Intronic
948759390 2:240181205-240181227 TCTCCCCTAGAGCCGCTGGAGGG - Intergenic
948846457 2:240685085-240685107 CCTGCCCTTCCGCAGCGGGAGGG + Intergenic
948847405 2:240689648-240689670 CCTGCCCTTCCGCAGCGGGAGGG - Intergenic
1170408351 20:16063232-16063254 CCTCCCCTGCTCCATGTGGAGGG - Intergenic
1171069069 20:22048799-22048821 CCTCCCCCACAGCAGATGGAAGG + Intergenic
1171183473 20:23108311-23108333 CATCCCATGCTCCAGCTGGAGGG + Intergenic
1172318023 20:33971516-33971538 CCTCACCTAGGGCAGCAGGAAGG + Intergenic
1175229317 20:57463596-57463618 CCTCCCCTATAGCCTCTGGAGGG + Intergenic
1175816998 20:61888367-61888389 CCTCCCTTGCAGCGGCTGGACGG - Intronic
1175860910 20:62149527-62149549 CCTGCCCTCCTGCAGCTCCATGG - Intronic
1175922850 20:62458199-62458221 CCTCCTCCACAGCAGCAGGAGGG - Intergenic
1181173580 22:21023585-21023607 GCTCTTCTCCTGCAGCTGGAAGG - Exonic
1182737815 22:32543579-32543601 CCACCGCCACTGCAGCTGGGAGG - Intronic
1183191779 22:36326252-36326274 CCTCCCCTTCTGAGGCTGGAAGG - Intronic
1183265572 22:36823206-36823228 CCTCCCCTCCACCAGCTGGGAGG - Intergenic
1183742575 22:39677170-39677192 CCACCCCTACAGGACCTGGAGGG - Intronic
1183787239 22:40036851-40036873 CCTCCCCTAGGTCAGCTAGACGG + Exonic
1184186906 22:42871166-42871188 CCTTTCCGAGTGCAGCTGGAGGG - Exonic
1184483151 22:44759844-44759866 CCTCACCTCTTGCAGCTGGAGGG + Intronic
1185039991 22:48498926-48498948 TCTCCACTTCTGCAGCTGGACGG + Intronic
1185147234 22:49145222-49145244 CCTTCCCTCCTGTAGCTGCAGGG + Intergenic
1185224358 22:49644406-49644428 CCTGCCCTTCTGCCGATGGATGG + Intronic
949939015 3:9139542-9139564 TCTCCCCTAGAGCCGCTGGAGGG + Intronic
950465942 3:13153669-13153691 CCACCCCTCCTGCAGCAGGTGGG + Intergenic
951971078 3:28444358-28444380 CCTCCCCTGATGCAGCTGCCAGG - Intronic
952391396 3:32883906-32883928 ACTTCCCTTCTGAAGCTGGAAGG - Intronic
953165084 3:40457604-40457626 CCTCCGCCGCTGGAGCTGGATGG + Intronic
958499516 3:94887653-94887675 CCTCCCCTAATGCAGTTGCCAGG + Intergenic
960944883 3:122958951-122958973 TCTTCCCCATTGCAGCTGGAGGG - Intronic
962461839 3:135621380-135621402 CTTCCCCTGCTGCAGCCAGAGGG - Intergenic
963844401 3:150140801-150140823 CCTCCACGCCTGCAGCTGCATGG + Intergenic
963852660 3:150223941-150223963 CTTCATCTCCTGCAGCTGGAAGG + Intergenic
964696749 3:159516566-159516588 CCTTCCATTCTGCAGCTAGATGG + Intronic
966608371 3:181844304-181844326 CCTCCCCTCCAGCAGGTAGAGGG - Intergenic
968896912 4:3409663-3409685 CCTCCCTTGCTGCCGGTGGAGGG - Intronic
969325437 4:6441367-6441389 GCTCCTCCCCTGCAGCTGGAGGG - Intronic
969601534 4:8179382-8179404 TCTCCCCATCTGCATCTGGAAGG - Intergenic
970386587 4:15562909-15562931 ACTCAGCTACTCCAGCTGGAAGG - Intronic
970440732 4:16079126-16079148 CCTCCAGCACAGCAGCTGGAAGG + Intronic
970889312 4:21025215-21025237 CCTCCCCTACCTCACCTGTATGG - Intronic
971142907 4:23944409-23944431 TCTGCCCTAATGAAGCTGGAGGG - Intergenic
972938920 4:44172916-44172938 CCAGCACTACTGGAGCTGGAGGG - Intergenic
974683639 4:65195722-65195744 CCTCACCCACTGCTGCTGCAGGG - Intergenic
977771710 4:100868526-100868548 CCTGCTATGCTGCAGCTGGAAGG - Intronic
979644625 4:123053689-123053711 GCTCCCAGACTGCAGCAGGAGGG + Intronic
980281210 4:130722658-130722680 CCTCTGCTAGTGCAGGTGGAGGG - Intergenic
982260231 4:153488369-153488391 CACCCCGTCCTGCAGCTGGAGGG + Intronic
985728265 5:1526855-1526877 CCTTCTCTGCTGCAGCTGGAAGG + Intergenic
990511338 5:56492107-56492129 CATCCCACACTGCAGGTGGAAGG - Intergenic
991256689 5:64622052-64622074 CCTCATCTTCTGTAGCTGGAGGG - Intergenic
992041279 5:72835976-72835998 CCTACCCAACTGTATCTGGAAGG - Intronic
996081298 5:119261170-119261192 CCTCCCCTCTTAAAGCTGGATGG - Intergenic
996880141 5:128287795-128287817 CCTCCCCTCCTTCCTCTGGATGG - Intronic
997385263 5:133467510-133467532 CCGCCCCTACTGCGACTGAAAGG + Intronic
997598706 5:135124903-135124925 GCTGCCCGTCTGCAGCTGGAGGG - Intronic
997872217 5:137516291-137516313 TCTCCCCTACCCCAGCTGCATGG - Intronic
998967896 5:147560502-147560524 CCCACCCTACAGCAGCTTGAAGG + Intergenic
999274359 5:150319163-150319185 CCTCCTGGAATGCAGCTGGAGGG - Intronic
999535026 5:152506648-152506670 CCTCATCTCCTGCAGCTAGAGGG - Intergenic
1000988624 5:167888518-167888540 TCTCTCCTACTGCAGATAGAGGG - Intronic
1001532018 5:172469923-172469945 CCTCCCCTACTGCACCACCAGGG - Intergenic
1005099117 6:22150267-22150289 CCTCCCCTCATGCATCTTGAGGG - Intergenic
1006474660 6:34246307-34246329 CCTCCCTTCCTGCAGCCTGAAGG - Intergenic
1007345216 6:41223905-41223927 CTTCCCAAACTGCAGCTGGAGGG - Intergenic
1012709661 6:102582683-102582705 CCTACCCCACTGCAGCTGGCAGG + Intergenic
1015259353 6:131217331-131217353 CGCCACCTGCTGCAGCTGGATGG + Intronic
1015334701 6:132023718-132023740 CCAGGCCTACTGCAGCTAGATGG - Intergenic
1015896906 6:138026354-138026376 CATCCATTACTGCTGCTGGAAGG - Intergenic
1016425599 6:143933303-143933325 CCTCTACTATTGCAGCTGGCTGG - Intronic
1017331947 6:153209553-153209575 CCTCCCCTAAAGCCTCTGGAGGG - Intergenic
1017598455 6:156055571-156055593 CCTCCCCTACTGGGTCTGGGAGG - Intergenic
1017907992 6:158769898-158769920 CCTCTCCTCCTCCAGCTGCAGGG + Exonic
1018207011 6:161445612-161445634 CCACCCGTGCTGCAGCTGAATGG + Intronic
1018908696 6:168089638-168089660 CCTGCCCCAGTGCTGCTGGAAGG - Intergenic
1019318073 7:400626-400648 CCTCCCCTAATACACCTGGGTGG - Intergenic
1019536680 7:1533124-1533146 CCTCATCTACAGCAGCTGGTCGG - Intronic
1019911219 7:4101571-4101593 CCTCCCCTGCTGCACATGGTGGG - Intronic
1022498805 7:30869813-30869835 TCTCCCCTCCTGCAGCACGAGGG - Intronic
1023819086 7:43970449-43970471 CCTCCCCTAGGGCTGCTGGGAGG + Intergenic
1023819135 7:43970713-43970735 CCTCCCCTAGGGCTGCTGGGAGG + Intergenic
1025236535 7:57238313-57238335 CCTACCCCTCTGCAGATGGAGGG + Intergenic
1026953049 7:74360254-74360276 CCTCTCCTCCTCCAGCTGGTTGG - Exonic
1028622486 7:92840389-92840411 CCTCCACTGCTGCAACTGAATGG - Intergenic
1029744139 7:102507408-102507430 CCTCCCCTAGGGCTGCTGGGAGG + Intronic
1029744186 7:102507676-102507698 CCTCCCCTAGGGCTGCTGGGAGG + Intronic
1029762130 7:102606571-102606593 CCTCCCCTAGGGCTGCTGGGAGG + Intronic
1029762177 7:102606838-102606860 CCTCCCCTAGGGCTGCTGGGAGG + Intronic
1031967436 7:128037201-128037223 TCTCCCCTACGGCCTCTGGAGGG - Intronic
1033412122 7:141127597-141127619 TCTCCCCTACAGCCTCTGGAAGG + Intronic
1033759310 7:144422731-144422753 CCCCTCCTCCTGCAGCTTGAAGG + Intergenic
1033785051 7:144719889-144719911 CCTCCAAGACTGAAGCTGGAGGG - Intronic
1033929440 7:146505203-146505225 CATCCCCTGCTGCTGCTTGAAGG + Intronic
1036533092 8:9615285-9615307 CTTCCCATACTGCTGCTTGAAGG + Intronic
1036642234 8:10591753-10591775 CCTGCCCTCCTGCACATGGAGGG - Intergenic
1036738792 8:11343152-11343174 CCTCTACTCCTGCAACTGGAAGG + Intergenic
1037394112 8:18423976-18423998 CTTCCACTTCTCCAGCTGGATGG - Intergenic
1039273258 8:35906571-35906593 CCCCCACTCCTGCAGCTGTATGG + Intergenic
1040437758 8:47409452-47409474 CATCCCCTACTCTAGATGGAGGG - Intronic
1041381418 8:57257951-57257973 CCTGCCCTCCTGCAGCTGCAGGG - Intergenic
1041384065 8:57280040-57280062 TCCCCCCTCCTGCAGCTGAAGGG - Intergenic
1042669668 8:71247248-71247270 CCTCCTCTAGGGCTGCTGGAAGG - Intronic
1043234176 8:77840753-77840775 CCTCCCTTAATGCTGCTGGCAGG - Intergenic
1045443674 8:102239169-102239191 CCTCCCCTACTGCGGCCTAAGGG + Intergenic
1047766119 8:127991520-127991542 CATGCCCTGCTGCACCTGGAGGG + Intergenic
1047982714 8:130199506-130199528 CCTCCCATCCTGCAGCTGTTAGG + Intronic
1049548281 8:143244968-143244990 CCCCTCCTACAGCAGCTGGAGGG - Intergenic
1050489491 9:6173006-6173028 GTTCCCCAACTGCAGCAGGATGG - Intergenic
1052597277 9:30575804-30575826 CATCGGCTACTGCAGCGGGATGG - Intergenic
1053301729 9:36957229-36957251 CTTCCCCTCCTGCAACTGGGTGG + Intronic
1055057502 9:72037335-72037357 CCTCCCCTATTGGAGCTTGCCGG - Intergenic
1055401525 9:75929559-75929581 CCTCCCCTACTGCAGCTGGAGGG - Intronic
1060883395 9:127134081-127134103 CGGCGCCTGCTGCAGCTGGATGG - Intronic
1060980104 9:127786622-127786644 CCTCCCCCACTACAGGAGGAGGG - Intronic
1061877740 9:133553358-133553380 CCTCGTGTCCTGCAGCTGGAAGG - Intronic
1061955627 9:133959865-133959887 CCTCCCCTAGTGCCTCTGGAGGG + Intronic
1062151269 9:135020404-135020426 CCTCCCCTAGAGCTTCTGGAGGG + Intergenic
1062158623 9:135067650-135067672 CCTCCCCTAGAGCCTCTGGAGGG + Intergenic
1185445191 X:254158-254180 CCTCCACTACAGCTCCTGGAGGG - Intergenic
1185484913 X:474929-474951 CCTCCCCTAGGGCCTCTGGAGGG - Intergenic
1185548466 X:965237-965259 CCTCCCCTACAGCCTGTGGAGGG - Intergenic
1185650474 X:1644141-1644163 CCTCCCCTAGAGCCTCTGGAGGG + Intergenic
1185653675 X:1667407-1667429 CCTCCCCTAGAGCCTCTGGAGGG - Intergenic
1185677088 X:1857897-1857919 CCTCCCCTAGAGCTTCTGGAGGG - Intergenic
1185704945 X:2260021-2260043 CCTCCCCTAGAGCCTCTGGAGGG - Intronic
1185710317 X:2298203-2298225 CCTCCCCTAGAGCGTCTGGATGG + Intronic
1187187267 X:16998801-16998823 CCTCCACTCCTGCACCGGGAAGG + Intronic
1187773659 X:22730755-22730777 CACCCCCTACTGCAGCTGGGAGG - Intergenic
1189915908 X:45855785-45855807 CCTCCCCTAGAGGAACTGGAGGG + Intergenic
1190279279 X:48918741-48918763 CCTCCCCTACTGCAACCAGACGG - Intronic
1192198413 X:69047862-69047884 CCACCTCTCCTGCAGCTGGTGGG - Intergenic
1199595319 X:149502354-149502376 CTTGCCCAAATGCAGCTGGAGGG - Intronic
1199694720 X:150335701-150335723 GCTCCCCAACTGCTGCTGAAGGG - Intergenic
1199770291 X:150970884-150970906 CATCCCCTACAGCAGCAGGGAGG + Intergenic
1200050980 X:153431598-153431620 CCTCCCCTAGAGCCTCTGGAGGG + Intergenic
1200062262 X:153488868-153488890 CCTGCCCTCCTGCAGCTGAGGGG - Intronic
1201455053 Y:14160424-14160446 CTTCCCCCACTACAGCTTGAAGG - Intergenic