ID: 1055402020

View in Genome Browser
Species Human (GRCh38)
Location 9:75934135-75934157
Sequence CTGAAATAGGAGTGCATTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 300}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055402020_1055402026 -3 Left 1055402020 9:75934135-75934157 CCTGGAATGCACTCCTATTTCAG 0: 1
1: 0
2: 1
3: 13
4: 300
Right 1055402026 9:75934155-75934177 CAGGAGAGTGGGGCCATTGCAGG No data
1055402020_1055402027 8 Left 1055402020 9:75934135-75934157 CCTGGAATGCACTCCTATTTCAG 0: 1
1: 0
2: 1
3: 13
4: 300
Right 1055402027 9:75934166-75934188 GGCCATTGCAGGCCAGCCCAAGG No data
1055402020_1055402028 9 Left 1055402020 9:75934135-75934157 CCTGGAATGCACTCCTATTTCAG 0: 1
1: 0
2: 1
3: 13
4: 300
Right 1055402028 9:75934167-75934189 GCCATTGCAGGCCAGCCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055402020 Original CRISPR CTGAAATAGGAGTGCATTCC AGG (reversed) Intronic
900976018 1:6016868-6016890 CTGAAATAGGTCTGCCTTCTGGG + Intronic
901569445 1:10147738-10147760 CTGAATTAGGTGGGTATTCCTGG - Intronic
904106722 1:28090807-28090829 CTGAAATAGGAATGCATTGGAGG - Intergenic
904893472 1:33796847-33796869 CTGGGAAAGGAATGCATTCCTGG + Intronic
905468689 1:38175585-38175607 CTGAACTAGCAGTGTTTTCCTGG - Intergenic
906293372 1:44634219-44634241 TTGAAACAGGAGGGCATTCTAGG + Intronic
908761225 1:67513762-67513784 CTGGGAAAGGAATGCATTCCTGG + Intergenic
908877588 1:68695644-68695666 CTGAACTAGGAATGACTTCCAGG - Intergenic
909352444 1:74670890-74670912 CTGGGAAAGGAATGCATTCCTGG + Intronic
909870089 1:80728466-80728488 CTGAAATAGAACTGGTTTCCTGG - Intergenic
911249300 1:95557126-95557148 CTGGGAAAGGAATGCATTCCTGG + Intergenic
911549002 1:99256781-99256803 GTGAGATATGAATGCATTCCAGG + Intergenic
912439047 1:109684630-109684652 CTGGGAAAGGAATGCATTCCTGG + Intronic
912442354 1:109709081-109709103 CTGGGAAAGGAATGCATTCCTGG + Intronic
913189382 1:116400655-116400677 CTGAGATTGGAGTGTATGCCTGG + Intronic
915951863 1:160194989-160195011 CTGAAAGAGGAGGACATTGCAGG - Intronic
916347275 1:163807880-163807902 CTGGAATAGGAGTGCACTGGGGG - Intergenic
916480663 1:165211705-165211727 CTAAAATAGGAGTGTACTCAGGG + Intronic
916599978 1:166283233-166283255 CTGATATAGGAGTGGAATCGGGG + Intergenic
917078914 1:171236671-171236693 CTGGGAGAGGAATGCATTCCTGG - Intergenic
917381110 1:174409677-174409699 CTGGGAAAGGAATGCATTCCTGG + Intronic
918087052 1:181254670-181254692 CTGGGAAAGGAATGCATTCCTGG + Intergenic
918176008 1:182045784-182045806 CTGGGAAAGGAATGCATTCCTGG - Intergenic
918453241 1:184681111-184681133 CTGGGAAAGGAATGCATTCCTGG - Intergenic
918461741 1:184783867-184783889 CTGGGAAAGGAATGCATTCCTGG + Intergenic
918848058 1:189644509-189644531 CTGGGAAAGGAATGCATTCCTGG - Intergenic
920909017 1:210196609-210196631 CTGGGAAAGGAATGCATTCCTGG - Intergenic
921051756 1:211516044-211516066 CTGAATTAGGAGAGCTCTCCTGG - Intergenic
921900437 1:220444541-220444563 CTGGGAAAGGAATGCATTCCTGG + Intergenic
1064779076 10:18813187-18813209 CTGGGAAAGGAATGCATTCCTGG - Intergenic
1065499651 10:26367029-26367051 CTGGGAAAGGAATGCATTCCTGG + Intergenic
1066257056 10:33690292-33690314 CTGGGAAAGGAATGCATTCCTGG + Intergenic
1067014000 10:42741759-42741781 CTGGGAAAGGAATGCATTCCTGG - Intergenic
1067174313 10:43931742-43931764 CTGGAGCTGGAGTGCATTCCAGG - Intergenic
1067841750 10:49686579-49686601 CTGGGAAAGGAATGCATTCCAGG + Intronic
1068568094 10:58597691-58597713 CTGGGAAAGGAATGCATTCCTGG - Intronic
1069198409 10:65582972-65582994 CTGGGAAAGGAATGCATTCCTGG + Intergenic
1070463346 10:76691739-76691761 CTGGGAAAGGAATGCATTCCTGG - Intergenic
1070668439 10:78361620-78361642 TGGAAATAGGTCTGCATTCCAGG - Intergenic
1073353946 10:102838765-102838787 CTGGGAAAGGAATGCATTCCTGG - Intergenic
1073373009 10:103007523-103007545 CTGGGAAAGGAATGCATTCCTGG - Intronic
1073548003 10:104369362-104369384 CAGAAATAGGAGAGGTTTCCAGG + Intronic
1074720279 10:116257941-116257963 CTGAATGGGGAGAGCATTCCAGG - Intronic
1076748220 10:132525107-132525129 CTGGAAGAGGAATGCCTTCCTGG + Intergenic
1076761639 10:132608773-132608795 CTGAAACAGGATTTCAGTCCCGG - Intronic
1077594475 11:3519927-3519949 CTGGGAAAGGAATGCATTCCTGG + Intergenic
1079975863 11:27090811-27090833 CTGGGAAAGGAATGCATTCCTGG - Intronic
1080155429 11:29105510-29105532 CCGAAAAAGGAATGCATTTCTGG + Intergenic
1082282135 11:50281413-50281435 CTGGGAAAGGAATGCATTCCTGG + Intergenic
1082291774 11:50384238-50384260 CTCAGAAAGGAATGCATTCCTGG + Intergenic
1084822464 11:71702144-71702166 CTGGGAAAGGAATGCATTCCTGG - Intergenic
1087144511 11:94798776-94798798 CCGAATTAGGAGAGCATTGCAGG + Intronic
1087638222 11:100727382-100727404 CTGACATAGTGGTGAATTCCTGG + Intronic
1091410451 12:235830-235852 CTGGGAAAGGAATGCATTCCTGG + Intronic
1092420647 12:8328716-8328738 CTGGGAAAGGAATGCATTCCTGG + Intergenic
1093553562 12:20444736-20444758 ATGAAATACCAGTGCATGCCTGG + Intronic
1093729875 12:22555125-22555147 CTGGGAAAGGAATGCATTCCTGG - Intergenic
1094415135 12:30208160-30208182 CTGAAAAAGGAGTTCAACCCAGG + Intergenic
1095714586 12:45328983-45329005 CTGAGATTGGAGAGTATTCCAGG - Intronic
1097135756 12:56853510-56853532 CTGGGAAAGGAATGCATTCCTGG + Intergenic
1097409232 12:59229802-59229824 CTTAAACAGGAGTGTATTCTGGG + Intergenic
1098284403 12:68893270-68893292 CAGAAATCGCAGTGCATGCCAGG - Intronic
1099318880 12:81119562-81119584 CTGGGAAAGGAATGCATTCCTGG - Intronic
1102573017 12:113839082-113839104 CTGAGATCTGAGTGCCTTCCTGG + Intronic
1107805132 13:44146569-44146591 CTGGAAGACGAGGGCATTCCAGG + Intronic
1108791492 13:53973613-53973635 CTGGGAAAGGAATGCATTCCTGG - Intergenic
1111011251 13:82317720-82317742 CTGGGAAAGGAATGCATTCCTGG - Intergenic
1111452287 13:88435082-88435104 CTGGGAAAGGAATGCATTCCTGG + Intergenic
1112053642 13:95670142-95670164 CTGGGAAAGGAATGCATTCCTGG - Intergenic
1113214041 13:108017440-108017462 CTGGGAAAGGAATGCATTCCTGG + Intergenic
1113536613 13:111071705-111071727 CTGGGAAAGGAATGCATTCCTGG - Intergenic
1114750550 14:25199982-25200004 CTGGAAAAGGAATACATTCCTGG - Intergenic
1115135661 14:30104779-30104801 GTGAAATATGTGTGAATTCCAGG - Intronic
1115386567 14:32804799-32804821 CTGGGAAAGGAATGCATTCCTGG - Intronic
1115810911 14:37106350-37106372 CTGGGAAAGGAATGCATTCCTGG + Intronic
1116167194 14:41349552-41349574 CTAAAATTGGAGTGGGTTCCAGG - Intergenic
1116200764 14:41792524-41792546 CTGGGAAAGGAATGCATTCCTGG - Intronic
1117098629 14:52322714-52322736 CTGGAGAAGGAATGCATTCCTGG - Intronic
1117201623 14:53395548-53395570 CTGGGAAAGGAATGCATTCCTGG - Intergenic
1117764110 14:59062199-59062221 TTAAAATAGGATTGCATGCCAGG - Intergenic
1118216367 14:63812196-63812218 CTGGGAAAGGAATGCATTCCTGG - Intergenic
1119101869 14:71887506-71887528 CTGGGAAAGGAATGCATTCCTGG + Intergenic
1119299796 14:73562638-73562660 CTGGGAAAGGAATGCATTCCTGG + Intergenic
1120538043 14:85721507-85721529 CTGAAATATCAGTGCTTTCTGGG + Intergenic
1120712843 14:87810559-87810581 CTGGAAAAGGAGGGCATTTCAGG + Intergenic
1120884327 14:89440242-89440264 CTGATCTAGGGGTGCTTTCCTGG + Intronic
1122844271 14:104482318-104482340 CTGGGAAAGGAATGCATTCCTGG - Intronic
1202889803 14_KI270722v1_random:145269-145291 CTGGGAAAGGAATGCATTCCCGG - Intergenic
1124225763 15:27893563-27893585 CTGGGAAAGGAATGCATTCCTGG + Intronic
1125874053 15:43128575-43128597 CTGGGAAAGGAATGCATTCCTGG + Intronic
1127621215 15:60736561-60736583 CTGAAAAAGAAGTGCATTGGAGG + Intronic
1127949292 15:63788918-63788940 CATTAATAGGAGTTCATTCCAGG + Intronic
1128244535 15:66124154-66124176 CTGGAATATGAGGGCATTCAGGG - Intronic
1128354844 15:66918766-66918788 CTTAAAGAGGAGTACATTGCTGG - Intergenic
1129481492 15:75830104-75830126 GGGAAATGGGGGTGCATTCCTGG + Intergenic
1133021413 16:2968601-2968623 CTGAATAAGGGGTGCCTTCCCGG + Intronic
1133359355 16:5161769-5161791 CTGGGAAAGGAATGCATTCCTGG + Intergenic
1135968726 16:27056587-27056609 CAGAAGGAGGGGTGCATTCCTGG + Intergenic
1137934325 16:52619646-52619668 ATTAAATAGGTGTTCATTCCTGG + Intergenic
1138554724 16:57764751-57764773 CTGATACAGGAGGGTATTCCCGG + Intronic
1138984855 16:62315923-62315945 CTGAAATAGAAATGTATTCCTGG + Intergenic
1144535686 17:16087941-16087963 CTTAAATATGACTGCATTTCTGG - Intronic
1145830250 17:27910482-27910504 CTGAGATAGGTGTCCATTTCCGG - Intergenic
1146734131 17:35222753-35222775 CTGAAATAAAAATGCATACCTGG + Intergenic
1148994764 17:51700138-51700160 TTGAAATAGGAGAGCATCCTTGG + Intronic
1149182485 17:53956004-53956026 CTGGGAAAGGAATGCATTCCTGG - Intergenic
1149857234 17:60093332-60093354 CTGGGAAAGGAATGCATTCCTGG - Intergenic
1151078418 17:71300831-71300853 GTGAAATAGGAAGGCAGTCCAGG + Intergenic
1151246571 17:72799551-72799573 CTGGGAAAGGAATGCATTCCTGG + Intronic
1151665192 17:75541591-75541613 CTGAAAAAGGGGGTCATTCCGGG - Intronic
1151755168 17:76071002-76071024 CTGAAAAAGGAGGGCACTACTGG + Intronic
1152995732 18:404971-404993 CTGGGAAAGGAATGCATTCCTGG + Intronic
1155306613 18:24484744-24484766 CTGACATAGGTGGGCAGTCCTGG - Intergenic
1155323482 18:24642708-24642730 CTGGGAAAGGAATGCATTCCTGG - Intergenic
1155428513 18:25730674-25730696 CATAAAAAGGAGTGCATTCATGG - Intergenic
1156556119 18:38070084-38070106 CTGAGATAAGAGTGCATTCATGG + Intergenic
1157103108 18:44747899-44747921 CAGAACTAGGAGTGCAGTCTAGG - Intronic
1157406337 18:47425123-47425145 CTGAACTAGGTGTGCATTCCAGG - Intergenic
1158424470 18:57326736-57326758 AAGAAAAAGGAGTTCATTCCAGG + Intergenic
1158774042 18:60555403-60555425 CTGAAATTGGAGTGACTGCCAGG - Intergenic
1159347703 18:67228206-67228228 CTGGGAAAGGAATGCATTCCTGG + Intergenic
1159775160 18:72596542-72596564 CTGAAAGAAGAGGACATTCCTGG - Intronic
1160085637 18:75774940-75774962 GTGAATTAGGAATGCATTTCTGG - Intergenic
1160737252 19:669055-669077 CTGGGAAAGGAATGCATTCCTGG + Intergenic
1160830348 19:1101752-1101774 CTGAAATGGGAGTTTATTTCAGG - Intergenic
1163637473 19:18444021-18444043 CTGAAATAGCAGGGCAGGCCTGG + Exonic
1166015746 19:39978187-39978209 CTGAAGCAGGAGCCCATTCCAGG + Intronic
1166328612 19:42066120-42066142 CTCAGGTAGGAGTGAATTCCTGG + Intronic
1202665208 1_KI270708v1_random:112091-112113 CTGGGAAAGGAATGCATTCCCGG - Intergenic
925236757 2:2285579-2285601 CAGAAAGGGGAGGGCATTCCAGG - Intronic
925245371 2:2377879-2377901 CTGAATTTCCAGTGCATTCCAGG - Intergenic
926643063 2:15258502-15258524 CTGGGAAAGGAATGCATTCCTGG + Intronic
931774112 2:65525107-65525129 CTCACATAGGTGTGCATTCAGGG - Intergenic
932071967 2:68629405-68629427 CTGGGAAAGGAATGCATTCCTGG - Intronic
932484336 2:72073616-72073638 CTGGGAAAGGAATGCATTCCTGG - Intergenic
933656716 2:84894548-84894570 CTTCAATAGGAGTGAATTCAAGG + Intronic
935608062 2:104990643-104990665 ATGCAAAAGGAGTGGATTCCCGG + Intergenic
935824193 2:106927077-106927099 CTGGGAAAGGAATGCATTCCTGG - Intergenic
936463949 2:112730576-112730598 CTGAGACAGGAGTGGATGCCTGG + Intronic
937030141 2:118732082-118732104 CTGAGATTGGAGTGAAGTCCTGG - Intergenic
937112109 2:119374367-119374389 CTGGGAAAGGAATGCATTCCTGG - Intergenic
937606379 2:123806334-123806356 CTGGGAAAGGAATGCATTCCTGG - Intergenic
938507503 2:131901790-131901812 CTGGGAAAGGAATGCATTCCTGG - Intergenic
938842628 2:135177686-135177708 CTGGGAAAGGAATGCATTCCTGG - Intronic
939133147 2:138262161-138262183 CTGGGAAAGGAATGCATTCCTGG + Intergenic
940721137 2:157283472-157283494 CTGGCATAGGAATGCAATCCAGG - Intronic
941817684 2:169814016-169814038 CTGAAATAAGAGTGCAATAAGGG - Intronic
942035124 2:172003307-172003329 CTGAGATAGGAGAGAGTTCCTGG - Intronic
942296103 2:174518665-174518687 ATGAGACAGGAGAGCATTCCAGG - Intergenic
943226445 2:185185084-185185106 CTGAAATTGGAGTGGGTGCCAGG - Intergenic
943965500 2:194327597-194327619 CCGAAATAGGAGTGGGTACCAGG - Intergenic
944174825 2:196817739-196817761 CTGGGAAAGGAATGCATTCCTGG - Intergenic
945611556 2:212010836-212010858 CTGAGAAAGGAATGCATTCCTGG - Intronic
947071342 2:226291398-226291420 CTGGGAAAGGAATGCATTCCTGG + Intergenic
1176210267 20:63916773-63916795 CTGGGAAAGGAATGCATTCCTGG - Intronic
1177984733 21:27960564-27960586 CTGGGAAAGGAATGCATTCCTGG + Intergenic
1178858279 21:36268228-36268250 CTGGGAAAGGAATGCATTCCTGG - Intronic
1180331927 22:11489011-11489033 CTGGGAAAGGAATGCATTCCCGG - Intergenic
1180990858 22:19935208-19935230 CTGGAAAAGGAATGCATTCCTGG + Intronic
1182802332 22:33041727-33041749 ATGAAAAAGGATGGCATTCCAGG - Intronic
949217507 3:1587440-1587462 CTGGGAAAGGAATGCATTCCTGG + Intergenic
950231284 3:11277906-11277928 CTGGGAAAGGAATGCATTCCTGG - Intronic
951240676 3:20282930-20282952 CTGGGAAAGGAATGCATTCCTGG + Intergenic
952759562 3:36901971-36901993 TGAAAATGGGAGTGCATTCCTGG - Intronic
953987947 3:47459958-47459980 CTGGGAAAGGAATGCATTCCTGG - Intronic
956190628 3:66604611-66604633 CAGAAATAGGATTGGATTCTTGG + Intergenic
956220547 3:66898266-66898288 CTGTGAAAGGAATGCATTCCTGG + Intergenic
957090717 3:75727491-75727513 CTGGGAAAGGAATGCATTCCTGG + Intronic
959909565 3:111748412-111748434 CTGAAATAGGAGGGCAGGGCAGG + Intronic
961898326 3:130187916-130187938 CTGGGAAAGGAATGCATTCCTGG + Intergenic
961944241 3:130670015-130670037 CTGCATTAGGAGTGCCTCCCTGG - Intronic
962777326 3:138674370-138674392 CTGGAAGAGGGGTGGATTCCAGG + Intronic
964180265 3:153874855-153874877 CTGGGAAAGGAATGCATTCCTGG - Intergenic
964613007 3:158633664-158633686 CTGGGAAAGGAATGCATTCCTGG - Intergenic
965876840 3:173334142-173334164 TAGAAATAGGAGTGTTTTCCTGG - Intergenic
966199902 3:177351426-177351448 CTGCAATATTAGTGCTTTCCTGG + Intergenic
968041105 3:195590037-195590059 CTGGGAAAGGAATGCATTCCTGG - Intergenic
968176581 3:196555303-196555325 CTGAAATAGGAAAGCCTTCTTGG - Intronic
968980859 4:3848691-3848713 CTGAAATTGGAGTGGATGCCAGG + Intergenic
969008512 4:4041380-4041402 CTGGGAAAGGAATGCATTCCTGG + Intergenic
969712503 4:8852035-8852057 CTGCAGTGGGAGTGCAATCCAGG + Intronic
970057994 4:11996837-11996859 CTGGGAAAGGAATGCATTCCTGG - Intergenic
970578360 4:17449823-17449845 CTGGGATAGGAGTACATCCCTGG - Intergenic
971148289 4:24003622-24003644 CTGAAGTAGAAGTGAATTCCAGG + Intergenic
972897183 4:43638034-43638056 CTGAGAAAAGAATGCATTCCCGG + Intergenic
973208862 4:47592078-47592100 CTGACAGAGGAATGCATTCCTGG - Exonic
973223331 4:47753549-47753571 CTGGGGAAGGAGTGCATTCCTGG - Intronic
973659125 4:53084217-53084239 CTGGAAAAGGAATGCGTTCCTGG - Intronic
974605780 4:64147611-64147633 CTGGGAAAGGAATGCATTCCTGG - Intergenic
974999152 4:69198669-69198691 CTGGGAAAGGAATGCATTCCTGG + Intronic
975006631 4:69296584-69296606 CTGGGAAAGGAATGCATTCCTGG - Intronic
975016309 4:69424983-69425005 CTGGGAAAGGAATGCATTCCTGG - Intergenic
975819262 4:78253114-78253136 CTGAGGAAGGAATGCATTCCTGG - Intronic
975897893 4:79117160-79117182 CTGGGAAAGGAATGCATTCCTGG + Intergenic
976230325 4:82835951-82835973 CTGAAACACTCGTGCATTCCTGG + Intronic
976649320 4:87418297-87418319 CTGGGAAAGGAATGCATTCCTGG + Intergenic
976971115 4:91103967-91103989 CTGGGAAAGGAATGCATTCCTGG + Intronic
977720237 4:100231136-100231158 CTGGGAAAGGAATGCATTCCTGG - Intergenic
978193797 4:105947032-105947054 CTGGGAAAGGAATGCATTCCTGG - Intronic
979053697 4:115969917-115969939 CTGCATTAGGCGTGAATTCCTGG + Intergenic
979400626 4:120245237-120245259 CTGGGAAAGGAATGCATTCCTGG - Intergenic
980600600 4:135019345-135019367 CTGGGAAAGGAATGCATTCCTGG - Intergenic
981401218 4:144315481-144315503 CTGGGAAAGGAATGCATTCCTGG - Intergenic
981404656 4:144354030-144354052 CTGAAATAGAATTGCCTTTCAGG - Intergenic
983189587 4:164740837-164740859 CTGGGAAAGGAATGCATTCCTGG + Intergenic
983730544 4:170988174-170988196 ATGAAATAGGCTTGCATACCAGG + Intergenic
984157774 4:176212316-176212338 CTGGGAAAGGAATGCATTCCTGG + Intergenic
985115022 4:186582209-186582231 CTGGGAAAGGAATGCATTCCTGG + Intergenic
986983683 5:13476779-13476801 CAGATTTAGAAGTGCATTCCCGG - Intergenic
988484534 5:31657737-31657759 CTGAAATAAGAGCAAATTCCAGG + Intronic
989828681 5:45889711-45889733 CTGAAAAAATAATGCATTCCCGG - Intergenic
990704718 5:58515374-58515396 CTGAAATGGGAGGGAGTTCCCGG + Intergenic
991264086 5:64696563-64696585 CTGGGAAAGGAATGCATTCCTGG + Intronic
992230424 5:74658172-74658194 CAGCATTAGGAGGGCATTCCTGG + Intronic
993738785 5:91509879-91509901 CTGAAATAGGAGAGAAGTCCTGG - Intergenic
994877053 5:105437169-105437191 CTGGGAAAGGAATGCATTCCTGG - Intergenic
995366239 5:111364610-111364632 CTGAAATAGAAGTGTCTTTCTGG + Intronic
996097448 5:119413996-119414018 CTGGGAAAGGAATGCATTCCTGG + Intergenic
996101669 5:119451069-119451091 CTGGTAAAGGAATGCATTCCTGG - Intergenic
996517104 5:124383006-124383028 CTGGGAAAGGAATGCATTCCTGG + Intergenic
997597221 5:135115057-135115079 CCCAAATAGGAATTCATTCCCGG + Intronic
997736979 5:136220382-136220404 CTGGGAAAGGAATGCATTCCTGG + Intronic
999876673 5:155814265-155814287 GGGAAATAGGAGAACATTCCTGG - Intergenic
1002666409 5:180828889-180828911 CTGGGAAAGGAATGCATTCCTGG + Intergenic
1003572702 6:7266444-7266466 CTGTAAGAGAAGTGCCTTCCTGG - Intergenic
1006440764 6:34052328-34052350 CTGATTTAGGAGGGGATTCCAGG - Intronic
1006766402 6:36510376-36510398 CTGAAATTGGAGTGGACACCAGG + Intronic
1010803916 6:80212323-80212345 CTGGGAAAGGAATGCATTCCTGG - Intronic
1010810574 6:80294582-80294604 CTGGGAAAGGAATGCATTCCTGG + Intronic
1010816631 6:80365420-80365442 CTGGGAAAGGAATGCATTCCTGG - Intergenic
1011314717 6:86018660-86018682 CTGGGAAAGGAATGCATTCCTGG + Intergenic
1012602492 6:101115286-101115308 CTGATTTAGGTGTGCAATCCTGG + Intergenic
1012607146 6:101171315-101171337 CTGGGAAAGGAATGCATTCCTGG - Intergenic
1013647406 6:112159099-112159121 CTGAAATGGTAGAGCATTTCTGG - Intronic
1015036628 6:128663654-128663676 CCCAACTAGGAGTACATTCCTGG - Intergenic
1016855476 6:148666223-148666245 CTGGGGTAGGAATGCATTCCTGG + Intergenic
1019801791 7:3093175-3093197 CTGAAATAGGAGATCAGGCCAGG - Intergenic
1020429435 7:8104357-8104379 CAGAAATAGCAGTGAATTTCTGG + Intergenic
1020454946 7:8361217-8361239 TTGAAAGGGAAGTGCATTCCAGG - Intergenic
1020523637 7:9228472-9228494 CTGAAACAGGAGAGCATTGGCGG + Intergenic
1021552107 7:21882128-21882150 CTGAAATACGATTCTATTCCCGG - Intronic
1023300820 7:38769180-38769202 CTGAGAGAGGAGAGAATTCCAGG - Intronic
1024694830 7:51845402-51845424 CTGGGAAAGGAATGCATTCCTGG + Intergenic
1025743775 7:64225096-64225118 CTGGGAAAGGAATGCATTCCTGG - Intronic
1026443579 7:70464723-70464745 GTGGAAAAGGAGTGCATTTCTGG + Intronic
1027566583 7:79802123-79802145 CTGGGAAAGGAATGCATTCCTGG + Intergenic
1027859079 7:83552624-83552646 CTGGGAAAGGAATGCATTCCTGG + Intronic
1028331598 7:89601347-89601369 CTGGGAAAGGAATGCATTCCTGG - Intergenic
1029008529 7:97234293-97234315 CTGGGAAAGGAATGCATTCCTGG + Intergenic
1031605145 7:123760040-123760062 TTGAAACAGGCTTGCATTCCTGG + Intergenic
1031996951 7:128239226-128239248 CTGGGAAAGGAATGCATTCCTGG + Intergenic
1032004693 7:128291785-128291807 CTGGGAAAGGAATGCATTCCTGG + Intergenic
1034367002 7:150559857-150559879 CTGGGAAAGGAATGCATTCCTGG + Intergenic
1035572868 8:685171-685193 CTGGAAAAAGAATGCATTCCTGG - Intronic
1036249796 8:7152037-7152059 CTGGGAAAGGAATGCATTCCTGG + Intergenic
1037913615 8:22758898-22758920 CAGAAAGAGGAGTGAAGTCCGGG + Intronic
1039185473 8:34910847-34910869 CTGGGAAAGGAATGCATTCCTGG - Intergenic
1039501699 8:38022710-38022732 CTGGGAAAGGAATGCATTCCTGG - Intergenic
1040661760 8:49582933-49582955 CTGAAATTGGAGTGGGCTCCAGG - Intergenic
1042191406 8:66191218-66191240 CTGGGAAAGGAATGCATTCCTGG - Intergenic
1042358096 8:67851802-67851824 CTGAAATAGGGGTACATGCATGG - Intergenic
1042428886 8:68680943-68680965 CTGGGAAAGGAATGCATTCCTGG - Intronic
1043750783 8:83931193-83931215 CTGGGAAAGGAATGCATTCCTGG + Intergenic
1043861636 8:85324095-85324117 CTGGGAAAGGAATGCATTCCTGG - Intergenic
1044182286 8:89211028-89211050 CTGGGAAAGGAATGCATTCCTGG + Intergenic
1044434109 8:92141867-92141889 CTGTAATAGGAGAACATTCCAGG - Intergenic
1045557494 8:103228764-103228786 CTGGAATAGGAGGACTTTCCAGG - Exonic
1046282594 8:112053320-112053342 CTGGGAAAGGAATGCATTCCTGG - Intergenic
1046823495 8:118661533-118661555 CTGAAGTAGGAGTGCTTTTAGGG + Intergenic
1047009267 8:120653628-120653650 TTTAAATAGTAGTGCAGTCCTGG - Intronic
1047700999 8:127449310-127449332 CTGAAAGAGCAGTGATTTCCAGG - Intergenic
1047922280 8:129647527-129647549 CTGGGAAAGGAATGCATTCCTGG - Intergenic
1048033804 8:130657741-130657763 CTGGGAAAGGAATGCATTCCTGG - Intergenic
1048520358 8:135148210-135148232 AAGAAATAGGAGTCCTTTCCTGG + Intergenic
1048602181 8:135930162-135930184 CTGGGAAAGGAATGCATTCCTGG - Intergenic
1049174561 8:141183859-141183881 TTGAAACAGGAGTGGAGTCCAGG + Intronic
1050887711 9:10786464-10786486 CTGAAATAGGAATGCTATCAAGG + Intergenic
1051375091 9:16394444-16394466 CTGGGAAAGGAATGCATTCCTGG + Intergenic
1051496086 9:17725272-17725294 ATAAAAGAGGTGTGCATTCCAGG + Intronic
1052118810 9:24682733-24682755 CTGAAATAGAAGTGCAATACAGG - Intergenic
1054758561 9:68983675-68983697 CTGTAATGGCAGTGCATTACAGG + Intronic
1055402020 9:75934135-75934157 CTGAAATAGGAGTGCATTCCAGG - Intronic
1057100611 9:92355283-92355305 CTGGGAAAGGAATGCATTCCTGG - Intronic
1059198407 9:112392518-112392540 CTGGAAAAGGGATGCATTCCTGG - Intronic
1059199335 9:112399633-112399655 CTGGGAAAGGAATGCATTCCTGG - Intronic
1059299671 9:113302285-113302307 CTGAAACAGCAGTGGATCCCTGG - Intronic
1059635835 9:116169979-116170001 CTAAAATAGGAGTGCTATTCTGG - Intronic
1060400592 9:123346743-123346765 CTGAATTTGGAGAGCATTTCCGG + Intergenic
1060948167 9:127582664-127582686 CTGAAACAGGAGAGCTTTCTGGG - Intergenic
1185966711 X:4614015-4614037 CTGGGAAAGGAATGCATTCCTGG - Intergenic
1186293420 X:8123473-8123495 CTGAACTAGAAATGCATTCATGG - Intergenic
1186443470 X:9605888-9605910 CTGAAACTGGAGTGCATTGGTGG - Intronic
1187285619 X:17900402-17900424 CTGACATAGGAGAGAATTGCTGG - Intergenic
1189393535 X:40599246-40599268 CTGGAAGTGTAGTGCATTCCTGG + Intronic
1191044214 X:56118964-56118986 CTCAAATAGGAGGAAATTCCTGG + Intergenic
1191191639 X:57674439-57674461 CTGGGAAAGGAATGCATTCCTGG - Intergenic
1191814803 X:65231565-65231587 CTGGAGAAGGAATGCATTCCTGG - Intergenic
1192441533 X:71178245-71178267 CTGAGAGAGGACAGCATTCCAGG + Intergenic
1193272028 X:79540000-79540022 CTGAAACATTATTGCATTCCTGG + Intergenic
1193300750 X:79885894-79885916 CTGGGAAAGGAATGCATTCCTGG - Intergenic
1193980302 X:88174409-88174431 CTGGGAAAGGAATGCATTCCTGG - Intergenic
1194564129 X:95462073-95462095 CTGGAAAAGGAGGGCATTTCAGG - Intergenic
1195999351 X:110764764-110764786 CTGGGAAAGGAATGCATTCCTGG + Intronic
1196111657 X:111953064-111953086 CTGAAATAGGATTTCAATCCAGG - Intronic
1196944228 X:120808371-120808393 CTGAGAAAGGAATGCATTCCTGG + Intergenic
1197520667 X:127492229-127492251 CTGGGAAAGGAATGCATTCCTGG - Intergenic
1197817475 X:130512961-130512983 CTGGGAAAGGAATGCATTCCTGG - Intergenic
1198824280 X:140682942-140682964 CTGGGAAAGGAATGCATTCCTGG + Intergenic
1198857323 X:141032172-141032194 CTGGGAAAGGAATGCATTCCTGG - Intergenic
1198905372 X:141555194-141555216 CTGGGAAAGGAATGCATTCCTGG + Intergenic
1198996476 X:142579121-142579143 CTGGGAAAGGAATGCATTCCTGG + Intergenic
1199989373 X:152976834-152976856 CTGGGAAAGGAATGCATTCCTGG - Intergenic
1200372371 X:155740468-155740490 CTGGGAAAGGAATGCATTCCTGG + Intergenic
1200393138 X:155964458-155964480 CTGGGAAAGGAATGCATTCCTGG - Intergenic
1201967924 Y:19758658-19758680 CTGGGAAAGGAATGCATTCCTGG + Intergenic