ID: 1055402025

View in Genome Browser
Species Human (GRCh38)
Location 9:75934148-75934170
Sequence TGGCCCCACTCTCCTGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055402025_1055402028 -4 Left 1055402025 9:75934148-75934170 CCTATTTCAGGAGAGTGGGGCCA 0: 1
1: 0
2: 0
3: 13
4: 132
Right 1055402028 9:75934167-75934189 GCCATTGCAGGCCAGCCCAAGGG No data
1055402025_1055402027 -5 Left 1055402025 9:75934148-75934170 CCTATTTCAGGAGAGTGGGGCCA 0: 1
1: 0
2: 0
3: 13
4: 132
Right 1055402027 9:75934166-75934188 GGCCATTGCAGGCCAGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055402025 Original CRISPR TGGCCCCACTCTCCTGAAAT AGG (reversed) Intronic
901954778 1:12776262-12776284 TGGCAGCTCTGTCCTGAAATAGG + Intronic
901961074 1:12827089-12827111 TGGCGGCCCTGTCCTGAAATGGG - Intronic
901975469 1:12940824-12940846 TGGCGGCCCTGTCCTGAAATGGG - Intronic
901983068 1:13051958-13051980 TGGCGGCCCTGTCCTGAAATGGG - Intronic
901985949 1:13075378-13075400 TGGCGGCCCTGTCCTGAAATGGG + Intronic
901995860 1:13151389-13151411 TGGCGGCCCTGTCCTGAAATGGG - Intergenic
901999023 1:13176960-13176982 TGGCGGCCCTGTCCTGAAATGGG + Intergenic
902009706 1:13260941-13260963 TGGCGGCCCTGTCCTGAAATGGG + Intronic
902467666 1:16628301-16628323 GAGCCCCAGTTTCCTGAAATGGG + Intergenic
902506917 1:16944427-16944449 GAGCCCCAGTTTCCTGAAATGGG - Intronic
902612220 1:17603861-17603883 TGGCCCCATTTTCCTGAAGGAGG - Intronic
904554364 1:31348741-31348763 TTCCCCAAGTCTCCTGAAATGGG - Intronic
915884996 1:159712966-159712988 GGGCCCAGGTCTCCTGAAATGGG - Exonic
916034047 1:160905434-160905456 TGGTCCCATCTTCCTGAAATGGG - Intergenic
918722039 1:187865284-187865306 TGCCCCCACTCTCCTAATCTTGG + Intergenic
919834491 1:201564315-201564337 TGGCCCCATTCCCCTGTAATAGG - Intergenic
921934382 1:220783349-220783371 TGGGTCCACTCTCCCCAAATGGG - Intronic
922723974 1:227914130-227914152 AGGCCCCAGTCCCCCGAAATGGG + Intergenic
923460840 1:234208080-234208102 TGGCCTCAGTTTCCTGATATGGG - Intronic
1063919042 10:10913604-10913626 TGGTCCCAAACTCCTGAACTCGG + Intergenic
1073044313 10:100627740-100627762 TGGCCCCACACACCTGTAACTGG + Intergenic
1073996235 10:109318197-109318219 TGGCCACACACTGCTGTAATTGG + Intergenic
1075703647 10:124485285-124485307 TTGCCCCACCCTCCAGAAAAGGG + Intronic
1077210194 11:1367491-1367513 TGGTCTCAATCTCCTGAACTCGG + Intergenic
1077404229 11:2375723-2375745 TGGCTCCACTCTCAGGAAGTGGG - Intergenic
1083266212 11:61548112-61548134 TCACCCCACTCCCCTGAAAGGGG + Intronic
1083625003 11:64067808-64067830 CACCCCCACACTCCTGAAATGGG + Intronic
1083659333 11:64245030-64245052 TGGCCCCAGTCTCTTGGAAGTGG - Intronic
1083879615 11:65541503-65541525 TGGCCCCACCCTCCTAAATTTGG - Intronic
1088557150 11:111073357-111073379 TGGCCCCAGTCGTGTGAAATTGG - Intergenic
1090447164 11:126774379-126774401 AGGCCCCACTCTCCTGCCACGGG - Intronic
1090762715 11:129851204-129851226 GGGCCCCTCCCTCCTGAACTAGG - Intronic
1093514848 12:19973581-19973603 TGCCCCCATTCTCCTAAAGTGGG + Intergenic
1102715154 12:114964320-114964342 TGGCCCCAACCTCATGAAATTGG + Intergenic
1107546361 13:41437232-41437254 TGGCCACACTTTCATGACATTGG - Intergenic
1110142872 13:72152481-72152503 AGACTTCACTCTCCTGAAATGGG + Intergenic
1113450837 13:110408190-110408212 TGCCCCCTCCCTCCTGGAATGGG - Intronic
1114270333 14:21097238-21097260 TGTCCTCACTCTCCTGAGTTAGG + Intronic
1116466533 14:45239817-45239839 TGGCTCTACTCTCCTGAATGCGG - Intronic
1121280262 14:92692645-92692667 TGGCCCCACAATCCTTTAATGGG + Intergenic
1125085017 15:35719977-35719999 TGGCCACACTATCATTAAATTGG + Intergenic
1126587612 15:50305004-50305026 GAGCCCAATTCTCCTGAAATTGG + Intronic
1127541669 15:59945104-59945126 AGGCCCCACACTGCTGAAAGTGG + Intergenic
1127946420 15:63759026-63759048 TGGCTCCACTTTCCTTTAATAGG + Intronic
1128238439 15:66083039-66083061 TGGACACACTCTCATGAAAATGG - Intronic
1128467106 15:67922134-67922156 TGGTCTCAATCTCCTGACATGGG + Intergenic
1136142233 16:28294841-28294863 TGCCTCAACTGTCCTGAAATTGG - Intronic
1137712787 16:50578291-50578313 TGGCCCCACCCTGATGAAAGAGG + Intronic
1141210333 16:81973671-81973693 AGCACCCACTCTCCTGAATTAGG + Intergenic
1144539998 17:16131909-16131931 TGACCCCACTCTCATGAATGTGG + Intronic
1144739815 17:17575589-17575611 TGGCCCCAGCCTCCTGACATGGG - Intronic
1149571764 17:57677186-57677208 TGCCCCCACCCTCCTGAAAAGGG - Intronic
1150848534 17:68683091-68683113 TGGGCAGACTCCCCTGAAATTGG - Intergenic
1153882672 18:9434563-9434585 CAGCCCCACTCTCCGGAAACAGG + Intergenic
1154101814 18:11482186-11482208 TGGCTCCACTCCTTTGAAATAGG + Intergenic
1159174719 18:64817818-64817840 TGGACCTACTCTACAGAAATAGG - Intergenic
1160745771 19:710072-710094 TGGCTCCCCTGTCCTGAAGTGGG - Intronic
1163681114 19:18683311-18683333 TGGCCCCACCCTTGTGAATTGGG + Intergenic
1166310373 19:41959100-41959122 TGGCCCCGGTCTCCTCTAATGGG - Intronic
1168557008 19:57351688-57351710 TGCCCCCACTCACCTGAACCCGG - Exonic
926417610 2:12665348-12665370 TGGCCTTATTCTCCTGAAACAGG + Intergenic
927862089 2:26566354-26566376 TGGGACCACTCTCCTGACAATGG - Intronic
929114290 2:38431359-38431381 TGGCCGCAATCTGCTGAACTTGG - Intergenic
929937613 2:46305455-46305477 TGCCCCCACTCCCCCGAACTTGG + Intronic
931203340 2:60122663-60122685 TCACCCCACCCTCGTGAAATAGG + Intergenic
933113235 2:78431477-78431499 AGGCCCCACTCACCTGCAAGGGG - Intergenic
935442204 2:103112889-103112911 TGTCCCCAATCTCCTGACTTTGG - Intergenic
938303642 2:130233466-130233488 TGGCACCCCTCTCCTGAACGAGG + Intergenic
938453038 2:131440799-131440821 TGGCACCCCTCTCCTGAACGTGG - Intergenic
939148380 2:138443877-138443899 TGGCCCCAGTTTTCTGAATTGGG - Intergenic
941009841 2:160286856-160286878 TGGCTGCACACTTCTGAAATAGG - Intronic
946036091 2:216743395-216743417 AGGCCACACTCTCCTGAGGTGGG + Intergenic
1172620551 20:36315885-36315907 TGGCCTCACTCTGCTGACACTGG + Intronic
1174109011 20:48184874-48184896 TGGGCCCACTCTCCTCAAGGAGG + Intergenic
1174293130 20:49523189-49523211 TGGGCTCATTATCCTGAAATTGG + Intronic
1178637553 21:34317985-34318007 TGGCCCCACTGTCCTGAAGCAGG + Intergenic
1180132104 21:45833539-45833561 TCCACCCACTCTCCTGACATGGG - Intronic
1180709522 22:17830439-17830461 CGGCTCAACTCTCCTGAAAAGGG + Intronic
1180986446 22:19906957-19906979 TGCCCACACTCTCCTGAGAGCGG - Intronic
1180986503 22:19907312-19907334 TGCCCACACTCTCCTGAGAGCGG - Intronic
1180986508 22:19907351-19907373 TGCCCACACTCTCCTGAGAGCGG - Intronic
1180986577 22:19907786-19907808 TGCCCACACTCTCCTGAGAGCGG - Intronic
1180986598 22:19907903-19907925 TGCCCACACTCTCCTGAGAGCGG - Intronic
1181479222 22:23187334-23187356 TGGGCCCACTGGGCTGAAATAGG + Intronic
1182183192 22:28372803-28372825 TGGCCCCATTCTCCTGACTTCGG - Intronic
949961553 3:9316439-9316461 TGGTCTCAATCTCCTGACATTGG - Intronic
950190575 3:10973684-10973706 TGTCCCCACCTTCCTTAAATGGG + Intergenic
952404452 3:32992958-32992980 TGGCCCCACTGTCTGGACATCGG + Intergenic
952559781 3:34577920-34577942 TGTCACCACTCACCTGAAATTGG + Intergenic
953124733 3:40079741-40079763 TGGCCCCAGCCTTCTGAACTTGG - Intronic
953285282 3:41600617-41600639 TGTCCCCTCTCTCCTGAATGGGG + Intronic
955678844 3:61479003-61479025 TAGCCACACTCACCAGAAATTGG + Intergenic
956795717 3:72716905-72716927 GGGGCCCAATCTCCTCAAATGGG - Intergenic
961637437 3:128342266-128342288 AGGCCCCACTCTCTTGACCTTGG + Intronic
962482268 3:135808026-135808048 TGGCCTCAGTCTCCAGAATTAGG - Intergenic
964312387 3:155408656-155408678 CGGCCCCACTCTCATGACTTTGG + Intronic
969501880 4:7558481-7558503 GGGCCCCACTCTCCTGTAACAGG + Intronic
976097437 4:81524023-81524045 TGACCCCACTCTCTTGAATAGGG - Intronic
976634136 4:87270860-87270882 TGTCCCCTCTCTCCTGCACTGGG - Intergenic
977293432 4:95187742-95187764 TGGCCCCACTGTCTTTAAAATGG - Intronic
979150745 4:117311081-117311103 AGAACCCACTCTCCTGAATTAGG - Intergenic
980185689 4:129458350-129458372 TGACCCACCTCTCCTGAAAGTGG - Intergenic
982107664 4:152024793-152024815 AGGGCCCACTCTACTGCAATAGG - Intergenic
987869371 5:23593664-23593686 TGGCCCCACTTTTCTGTAAGTGG + Intergenic
1001273618 5:170334077-170334099 TGACTCCACTTTGCTGAAATAGG - Intergenic
1002775934 6:327500-327522 TGGCACCTCTCTCCTGTAAACGG - Intronic
1003846349 6:10178060-10178082 TGGGCCCTCTCTCCTCAAAGTGG - Intronic
1006285201 6:33087733-33087755 AGCCCCACCTCTCCTGAAATTGG - Intergenic
1007177297 6:39905705-39905727 TGGCCCCCCTCTTCTGAAACAGG - Exonic
1010332197 6:74636131-74636153 TTTCCCCATTCTCCTGAACTGGG - Intergenic
1014598903 6:123384307-123384329 TGACTCCACTATACTGAAATAGG + Intronic
1018207035 6:161445749-161445771 TGGGCCCACTTTCCTGCTATTGG + Intronic
1019629948 7:2043710-2043732 TGCCCCCACTCTCGAGAAAAAGG - Intronic
1020721604 7:11751828-11751850 CGGTCCCATCCTCCTGAAATGGG + Intronic
1021391562 7:20099508-20099530 TGGGCCCTCTCTCCTGCATTTGG + Intergenic
1021433015 7:20582991-20583013 TGGCCCTACATTCTTGAAATAGG + Intergenic
1031240201 7:119228245-119228267 TGGCCACACTGTGCAGAAATAGG + Intergenic
1035041063 7:155927559-155927581 AGACCCCATTCTCATGAAATTGG + Intergenic
1036527112 8:9545563-9545585 TGTCCCCATTATCCTGAAACAGG - Intergenic
1039371985 8:36994380-36994402 TTGCTCCACTTTGCTGAAATCGG + Intergenic
1039992042 8:42496804-42496826 AGCCCCCTCTCTTCTGAAATGGG + Intronic
1041082655 8:54228051-54228073 TGGGCCTTCTCTCTTGAAATAGG + Intergenic
1041109744 8:54473072-54473094 TGGCCCAACTCTCATGAAAATGG - Intergenic
1042109707 8:65367637-65367659 AGCACCCACTCTCCTGAATTAGG + Intergenic
1046530999 8:115444778-115444800 TGACTCCACCATCCTGAAATTGG + Intronic
1047967364 8:130056318-130056340 TGGCCCCACTCTGCTGACAGAGG + Intronic
1047976875 8:130139313-130139335 TGGCCCAAATCTTCTGCAATTGG - Intronic
1048326751 8:133445671-133445693 TGGCCCCAGTGTCTTGTAATGGG + Intergenic
1048418460 8:134252664-134252686 TGGGCCCACACTCATGACATTGG + Intergenic
1048680520 8:136836272-136836294 TTGCCCCTCTCTCATGAGATAGG + Intergenic
1048956275 8:139539184-139539206 TGTCCCCACTCTCCTGCTAGAGG + Intergenic
1053152281 9:35750648-35750670 TGGCCCCTCTCACCTGAAAAAGG - Exonic
1053529498 9:38865725-38865747 TGGTCTCAATCTCCTGACATCGG - Intergenic
1054201724 9:62090152-62090174 TGGTCTCAATCTCCTGACATCGG - Intergenic
1054636635 9:67498207-67498229 TGGTCTCAATCTCCTGACATCGG + Intergenic
1055402025 9:75934148-75934170 TGGCCCCACTCTCCTGAAATAGG - Intronic
1059329383 9:113525313-113525335 TGCCCCCACTCCCCTGAGACAGG + Intronic
1061187075 9:129060921-129060943 TGGCCTCAGTCTCCTGCCATGGG + Intronic
1061770524 9:132916880-132916902 AGGCCCCAGTCTCCTGGATTCGG + Intronic
1062524646 9:136973321-136973343 TGGGCCCACGCCCCTGAGATGGG - Intergenic
1186906345 X:14115099-14115121 AGTCACCACTCTACTGAAATTGG - Intergenic
1187504209 X:19865628-19865650 TGGCCCCACTGTTCTGGCATTGG - Intronic
1189464285 X:41266615-41266637 AGGGCCCCCTCTCCAGAAATTGG - Intergenic
1189507233 X:41624141-41624163 TGGATCCACTCCCCTTAAATAGG + Intronic
1189638243 X:43036363-43036385 TGCCCCTTCTCTCCTGAAACAGG + Intergenic
1192442213 X:71182899-71182921 TGGACCCAGACCCCTGAAATAGG + Intergenic