ID: 1055402027

View in Genome Browser
Species Human (GRCh38)
Location 9:75934166-75934188
Sequence GGCCATTGCAGGCCAGCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055402025_1055402027 -5 Left 1055402025 9:75934148-75934170 CCTATTTCAGGAGAGTGGGGCCA 0: 1
1: 0
2: 0
3: 13
4: 132
Right 1055402027 9:75934166-75934188 GGCCATTGCAGGCCAGCCCAAGG No data
1055402020_1055402027 8 Left 1055402020 9:75934135-75934157 CCTGGAATGCACTCCTATTTCAG 0: 1
1: 0
2: 1
3: 13
4: 300
Right 1055402027 9:75934166-75934188 GGCCATTGCAGGCCAGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055402027 Original CRISPR GGCCATTGCAGGCCAGCCCA AGG Intronic
No off target data available for this crispr