ID: 1055407692

View in Genome Browser
Species Human (GRCh38)
Location 9:75991804-75991826
Sequence TTGGTAGTCCCAGATTCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 213}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055407692_1055407694 -7 Left 1055407692 9:75991804-75991826 CCTTAAGAATCTGGGACTACCAA 0: 1
1: 0
2: 0
3: 16
4: 213
Right 1055407694 9:75991820-75991842 CTACCAATTGAGAAAGTTTAGGG No data
1055407692_1055407693 -8 Left 1055407692 9:75991804-75991826 CCTTAAGAATCTGGGACTACCAA 0: 1
1: 0
2: 0
3: 16
4: 213
Right 1055407693 9:75991819-75991841 ACTACCAATTGAGAAAGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055407692 Original CRISPR TTGGTAGTCCCAGATTCTTA AGG (reversed) Intronic
901316505 1:8313620-8313642 TAGGTAGTTCCAGCTACTTAGGG - Intergenic
902159452 1:14518298-14518320 TTTGTAGTCCCAGCTACTCAGGG - Intergenic
903483934 1:23675665-23675687 TTTGTAGTCCCAGCTACTTGGGG + Intergenic
905016202 1:34780631-34780653 TTGGGAGTCCCTGGATCTTAGGG - Intronic
906121737 1:43397649-43397671 TCTGTAGTCCCAGCTACTTAGGG - Intronic
906419062 1:45648062-45648084 CTGGTAGTCCCAGCTACTCAGGG - Intronic
906946469 1:50298679-50298701 TCTGTAGTCCCAGCTACTTACGG - Intergenic
907023179 1:51088268-51088290 TCTGTAGTCCCAGCTACTTAGGG + Intergenic
908500515 1:64738971-64738993 CTTGTAGTCCCAGCTACTTAGGG + Intergenic
908707204 1:66971216-66971238 TTGATATACACAGATTCTTAGGG - Intronic
908912710 1:69091303-69091325 TTGGTGGACCCAGTTTCTAAGGG - Intergenic
914238117 1:145830974-145830996 TTTGTAGTCCCAGCTACTCAGGG + Intronic
914455730 1:147834626-147834648 TTGGTAATCCTGGCTTCTTAGGG - Intergenic
915799065 1:158769285-158769307 TTTGTAGTCCCAGCTACTTGTGG - Intergenic
916165342 1:161961815-161961837 TTGCAAGTCCCAAATTTTTAAGG + Exonic
916751484 1:167726382-167726404 TTGTCTGTCCCAGATTCTGATGG - Intronic
917261927 1:173178992-173179014 TTGCTAGTTCCAGATTCTAGAGG - Intergenic
918748822 1:188243768-188243790 TTTGTAGTCCCAGGTTCTGAGGG + Intergenic
921272724 1:213487270-213487292 TTGGTAGTCCCAGCTACCTGGGG + Intergenic
923140131 1:231154831-231154853 TGGGTAGTCCCAGCTCTTTAAGG + Intergenic
923170742 1:231414857-231414879 TCTGTAGTCCCAGCTTCTTGAGG - Intronic
924608707 1:245556521-245556543 CTGGTAGTCCCAGCTACTTGGGG - Intronic
924955308 1:248920687-248920709 TTTCTAGTTCTAGATTCTTAAGG + Intergenic
1065259468 10:23909837-23909859 TTGCTAGTTCCAGATCCTTGAGG + Intronic
1065380794 10:25087966-25087988 ATGTTATGCCCAGATTCTTATGG - Intergenic
1066119876 10:32275811-32275833 GTGGTAGTCCCAGCTACTCAGGG + Intronic
1067288050 10:44921775-44921797 TTGGGAGGCCCAGAGTCTGAGGG - Intronic
1068413678 10:56689404-56689426 TTTGTAGTTCTAGATCCTTAAGG - Intergenic
1068931244 10:62592709-62592731 TTCTGAGACCCAGATTCTTAGGG + Intronic
1069869281 10:71523392-71523414 TTGGTAGTCCCCGAGTTTGAGGG - Intronic
1072581023 10:96740349-96740371 TGGGTAGGCCCAGATTCTCATGG + Intergenic
1073342594 10:102757009-102757031 TTGGTAATCCCAGCTACTCATGG - Intronic
1074774283 10:116755486-116755508 CCTGTAGTCCCAGATACTTAGGG + Intergenic
1075355549 10:121770405-121770427 TTGCTAATCTCAGATTATTAGGG - Intronic
1077293381 11:1811532-1811554 TTTGTAGTCCCAGCTACTTGGGG - Intergenic
1084105982 11:66980813-66980835 GTGGTAGTCCCAGCTACTTGGGG - Intergenic
1085622086 11:78045224-78045246 TTGGTAGTCCCAGCTACTTGAGG - Intronic
1086290773 11:85306694-85306716 CTGGTAGTCCCAGCTACTTAGGG - Intronic
1086895978 11:92313275-92313297 TTGGTAGTCCCAGATGTGGATGG - Intergenic
1087015490 11:93550549-93550571 CTGGTAGTCCCAGCTACTTGGGG + Intergenic
1087558136 11:99748651-99748673 TTTGGAGTCCCAGAGTCTGAAGG + Intronic
1087865449 11:103221125-103221147 TCGGTAGTACAAGACTCTTAAGG - Intronic
1088769812 11:113022731-113022753 TAGGTAGTCCAGGATTGTTATGG + Intronic
1089618560 11:119709314-119709336 CTGGTGATCCCAGATTCTCAGGG - Intronic
1092347528 12:7728299-7728321 TTTGTAGTCCCAGCTACTCAGGG - Intergenic
1092360245 12:7830510-7830532 CTGGTAGTCCCAGCTACTCAGGG + Intronic
1094056007 12:26270166-26270188 CTGATAGTCCCAGATTCTGGAGG - Intronic
1094463261 12:30721618-30721640 TTGCTATTGCCAGATTTTTATGG - Intronic
1095996768 12:48093840-48093862 CTGGTAGTCCCAGCTACTCAGGG + Intronic
1096989971 12:55792806-55792828 TTTGTAGTCCCAGCTACTTGGGG - Intronic
1097240462 12:57571691-57571713 CTTGTAGTCCCAGCTACTTAGGG - Intronic
1098167594 12:67714340-67714362 TGGGTAGACCCAGTTTCTAAGGG - Intergenic
1099904116 12:88751520-88751542 CCTGTAGTCCCAGATACTTAGGG + Intergenic
1100962204 12:99975026-99975048 CTGGTAGTCCCAGCTACTTGGGG + Intronic
1102200089 12:111051542-111051564 TAGTTACTCCCAGTTTCTTATGG + Intronic
1103093806 12:118117122-118117144 TTGGAATTCCCAATTTCTTAGGG + Intronic
1104447163 12:128843986-128844008 CTGGTAGTCCCAGCTACTTGGGG + Intergenic
1106471030 13:30054252-30054274 TGGGTGGACCCAGTTTCTTATGG + Intergenic
1107677371 13:42811124-42811146 CTAGTAGGCCCAGATTCTTGGGG + Intergenic
1107933634 13:45326737-45326759 CTTGTAGTCCCAGTTACTTAGGG + Intergenic
1110167632 13:72462214-72462236 TTGGTAATCCCAGTTACTCAGGG - Intergenic
1111117485 13:83799127-83799149 TTGTTAGTAGCAGAATCTTATGG - Intergenic
1115354201 14:32430224-32430246 TAGGCAATCACAGATTCTTAGGG + Intronic
1115911653 14:38263449-38263471 TTTCTAGTCCTAGAATCTTAAGG + Intergenic
1116986939 14:51230569-51230591 TTGGTATTACCAGATTCTGCAGG - Intergenic
1117600787 14:57372292-57372314 TTCAGATTCCCAGATTCTTAAGG + Intergenic
1118297387 14:64583012-64583034 CTTGTAGTCCCAGCTACTTATGG - Intronic
1120266000 14:82251782-82251804 TGGGTAGACCCAGTTTCTAAGGG + Intergenic
1125986617 15:44059404-44059426 TTGGTATTCTCAGATGTTTAAGG - Intronic
1128826570 15:70723359-70723381 TCGGTAGTCCCAGCTACTCAGGG + Intronic
1129294968 15:74595167-74595189 TGGGTAGTCCCAGCTACTCAGGG - Intronic
1131803939 15:96101852-96101874 TTGTTAGTCACTGATACTTAGGG + Intergenic
1136161569 16:28423055-28423077 TGTGTAGTCCCAGTTTCTTAGGG + Intergenic
1136201396 16:28691938-28691960 TGTGTAGTCCCAGTTTCTTAGGG - Intronic
1136217740 16:28806126-28806148 TGTGTAGTCCCAGTTTCTTAGGG - Intergenic
1137266561 16:46873810-46873832 CTTGTGGTCCCAGCTTCTTAGGG - Intergenic
1140962394 16:79928981-79929003 TTGGTCATCCCAGATGCTTCAGG + Intergenic
1141350076 16:83286630-83286652 CTGGTAGTCCCAGCTACTTGGGG + Intronic
1141369980 16:83478042-83478064 TTGGTGGTCCCAGCTGCTTGAGG + Intronic
1145858481 17:28185670-28185692 CTTGTAGTCCCAGATACTCAGGG - Intronic
1146095410 17:29925583-29925605 TGGGCAGTCCCAGATACTCAGGG + Intronic
1147268967 17:39253497-39253519 TGGGTAGTCACAGATACTCAGGG + Intergenic
1149939541 17:60848821-60848843 TTTGTAGTCCCAGCTACTTCAGG - Intronic
1150662362 17:67094196-67094218 TCTGTAGTCCCAGCTACTTAGGG + Intronic
1151254937 17:72869336-72869358 TTCGTAGTACCAGATTCTCTGGG - Intronic
1151783055 17:76260295-76260317 CTTGTAGTCCTAGCTTCTTAGGG + Intergenic
1152027743 17:77822693-77822715 TTGGTAGCCCTGGATTCTTCCGG + Intergenic
1153656402 18:7286640-7286662 TTGTAAGTCCCAGAGTCTGAAGG + Intergenic
1154142601 18:11838005-11838027 CTGGTAGTCCCAGCTACTTGGGG + Intronic
1154940650 18:21110667-21110689 ATGGTACTCCAAGATTCTTCAGG + Intronic
1156264300 18:35472146-35472168 TTTCTAGTTCTAGATTCTTAAGG + Intronic
1156296447 18:35796186-35796208 TTTCTAGTTCTAGATTCTTAAGG - Intergenic
1156670420 18:39462496-39462518 TGGGAAGTCCCAAATTTTTAGGG - Intergenic
1158369824 18:56787883-56787905 TTGGTAGGCCGATATTTTTAGGG + Intronic
1164000480 19:21093751-21093773 CTTGTAGTCCCAGTTACTTAGGG - Intronic
1166856483 19:45784897-45784919 TTGGGTGTCTCAGCTTCTTAGGG - Intronic
1166868500 19:45855869-45855891 CTGGTAGTCCCAGCTACTCAGGG + Intronic
1167159763 19:47759657-47759679 CTGGTAGTCCCAGCTACTTGGGG + Intergenic
1167392136 19:49202465-49202487 TAAGTAGTCCCAGCTACTTATGG - Intronic
1168488288 19:56784154-56784176 CTGGCAATCACAGATTCTTAAGG + Intronic
925640657 2:5983153-5983175 GTGGTGGTCCCAGAGCCTTATGG + Intergenic
925712179 2:6752174-6752196 CTGGTAGTCCCAGCTACTCAGGG + Intergenic
927623808 2:24691057-24691079 TTGGCAATCACGGATTCTTAAGG - Intronic
928308459 2:30190779-30190801 TGGGTAGGCCCAGTTTCTAATGG - Intergenic
929106664 2:38371772-38371794 TCTGTAGTCCCAGATACTCAGGG + Intronic
929472987 2:42215181-42215203 TCGGTAGTCCCAGCTACTTAGGG - Intronic
930386190 2:50698246-50698268 TTGGTAGTCCCTGAGACTTTCGG + Intronic
930869896 2:56159988-56160010 TGGGTAGACCCAGTTTCTAATGG - Intergenic
931215690 2:60242086-60242108 GTGTTAGTCCCAGAGTCTGAAGG - Intergenic
931544186 2:63362786-63362808 ATGGTAGTTCCAGCTACTTAGGG - Intronic
933637004 2:84719632-84719654 TTTGTAGTCCCAGATATTCAGGG - Intronic
933808765 2:86018841-86018863 TTGGGAGTCTCAGTTCCTTAAGG + Intergenic
934029187 2:88026459-88026481 CTTGTAGTCCCAGATGGTTAAGG + Intergenic
935529525 2:104215733-104215755 TGGGTAGACCCAGTTTCTAATGG - Intergenic
935639548 2:105277933-105277955 TCTGTAGTCCCAGATACTTGGGG + Intronic
936092822 2:109511980-109512002 TTGGGAGTCCCAGAGTCCTCTGG - Intergenic
937275141 2:120679331-120679353 TTGGTGGTCCCAGCGACTTAAGG - Intergenic
939494774 2:142914886-142914908 TTGGTGGACCCAGTTTCTAATGG + Intronic
939921492 2:148120038-148120060 CCTGTAGTCCCAGATACTTAGGG - Intronic
941771904 2:169353865-169353887 TCTGTAGTCCCAGCTTCTTGTGG + Intronic
941975777 2:171403634-171403656 TTGTTAGTAACAGATTCGTATGG - Intronic
944696864 2:202209525-202209547 TTTGTAGTCCCAGCTACTTGGGG - Intronic
945558205 2:211305383-211305405 CTGGTAGTACAAGATTCTTTAGG - Intergenic
945623202 2:212168516-212168538 TTCATAATTCCAGATTCTTAAGG + Intronic
947437967 2:230089456-230089478 TTTGTAGTCCCAGCTACTCAGGG - Intergenic
1169503961 20:6188511-6188533 TGGGAAGCCCCAGGTTCTTAAGG - Intergenic
1172586520 20:36089135-36089157 TTGTGAGCCCCATATTCTTAGGG - Intergenic
1172889612 20:38254660-38254682 ATGGTAGTCCCAGTTACTTTAGG + Intronic
1173782693 20:45769844-45769866 TCTGTAGTCCCAGCTACTTAGGG + Intronic
1176241378 20:64077302-64077324 TTGGTAGCCCCAGACTCTCGGGG - Intronic
1177095164 21:16823482-16823504 TCTGTAGTCCCAGTTACTTAGGG - Intergenic
1178325448 21:31641803-31641825 TGGGTAGACCCAGTTTCTAATGG + Intergenic
1178852023 21:36220622-36220644 TCTGTAGTCCCAGCTACTTAAGG - Intronic
1178911695 21:36679598-36679620 CTGGTAGTCCCAGCTACTCAGGG + Intergenic
1180377338 22:12106369-12106391 TTTGTAGTTCCAGATACTTGAGG + Intergenic
1182230238 22:28832308-28832330 CTTGTAGTCCCAGCTTCTTGGGG - Intergenic
1183843831 22:40523461-40523483 CCTGTAGTCCCAGATACTTAGGG - Intronic
949862903 3:8522539-8522561 ATGGTAGTCCCAGACCCTTTGGG - Intronic
951255528 3:20445176-20445198 TCTGTAGTCCCAGCTACTTAGGG + Intergenic
952359372 3:32614422-32614444 GTGGTAGTCCCAGGGTCCTATGG - Intergenic
954110668 3:48431059-48431081 TTGGAAGTCCCAGTTTCCTCTGG - Intergenic
955300881 3:57777460-57777482 TTTGTAGTCCCAGCTACTTGGGG + Intronic
955988268 3:64597937-64597959 TTGTTAGTTCCAGGTTCTGAAGG + Intronic
956331301 3:68112556-68112578 TTGTTAGTCCCAGACTCTAAGGG - Intronic
960584551 3:119308963-119308985 CCTGTAGTCCCAGCTTCTTAGGG - Intronic
963832636 3:150024489-150024511 TTGGTAGTGGCAGATTCTCTCGG - Intronic
964758329 3:160109524-160109546 CTGGTAGTCCCAGCTACTAAAGG - Intergenic
965785156 3:172327522-172327544 CTGGTAGTCCCAGCTACTCAGGG - Intronic
965924453 3:173959426-173959448 TTGTTAGTCCAGGATTCCTATGG - Intronic
970975192 4:22035393-22035415 TTTCTAGTTCCAGATTCTTGAGG + Intergenic
971383961 4:26126232-26126254 TTGGTAGTCCCTGCCTCTTATGG + Intergenic
972339429 4:38138440-38138462 TTGAAAGTCCCAGACTCTTGGGG - Exonic
973231255 4:47841550-47841572 TTTGTGGTCCCAGATTTTTTAGG - Intergenic
973798129 4:54449593-54449615 TTTGGAGTCCCAGATTGTTGCGG + Intergenic
973958770 4:56089146-56089168 TTTGTGGTCCCAGACTTTTAGGG - Intergenic
974868659 4:67611131-67611153 TCTGTAGTCCCAGGTACTTAGGG + Intergenic
975838065 4:78444966-78444988 TTGGACCTCCCAGTTTCTTAAGG - Intronic
976267179 4:83195411-83195433 TGGGTGGACCCAGATTCTAATGG - Intergenic
976724273 4:88200202-88200224 CTGGTAGTCCCAGCTACTTGGGG + Intronic
977922025 4:102656127-102656149 CTTGTAGTCCCAGCTTCTTGGGG + Intronic
978506611 4:109464404-109464426 CTGGTAGTCCCAGCTACTTGTGG - Intronic
979419585 4:120487473-120487495 TCTGTAGTCCCAGCTACTTAGGG + Intergenic
980456290 4:133047552-133047574 TCTGTAGTCCCAGCTACTTAGGG + Intergenic
982743832 4:159085817-159085839 TCTGTAGTCCCAGATACTTGGGG - Intergenic
984375504 4:178923630-178923652 TTGGCATTCCCATGTTCTTATGG - Intergenic
985485924 5:149415-149437 TTTGTAGTCCTAGCTACTTAAGG + Intronic
987391116 5:17376286-17376308 TTTCTAGTTCCAGATCCTTAAGG + Intergenic
988523363 5:31965500-31965522 TGGGTAGACCCAGTTTCTAATGG + Intronic
988770147 5:34425110-34425132 TTGACAGTCCCAGATACTTGAGG + Intergenic
989064150 5:37442809-37442831 TTGGTAATTTCAGATTCATATGG + Intronic
993547368 5:89229659-89229681 TTGATAGCTCCAGATTCTAAAGG - Intergenic
993718059 5:91294994-91295016 CTGGTAGTCCCAGCTACTTGTGG - Intergenic
994417962 5:99498637-99498659 TTGGTAATTTCAGATTCATATGG + Intergenic
994462002 5:100076516-100076538 TTGGTAATTTCAGATTCATATGG - Intergenic
1004225866 6:13783789-13783811 TTGGTTGTCCATGATTCTGAAGG - Intergenic
1004948220 6:20638755-20638777 TTTGTAATCCCAGATACTTATGG - Intronic
1004979419 6:21006723-21006745 GGGGTAGTCCCAGAATCCTACGG - Intronic
1006675416 6:35759093-35759115 TTTGTAGTCCCAGCTACTTGGGG + Intergenic
1007202383 6:40120907-40120929 TTGGTCTTCCCAGAAGCTTATGG - Intergenic
1009447012 6:63754735-63754757 TTTCTAGTTCTAGATTCTTAAGG + Intronic
1009743367 6:67778055-67778077 TTTGTAGTCCTGGGTTCTTAGGG + Intergenic
1009983497 6:70754352-70754374 TTGGAATTCACAGATTTTTAGGG + Intronic
1010099425 6:72086586-72086608 TTTGTACTCCCAGAGCCTTAAGG + Intronic
1010583556 6:77628906-77628928 TTGCTAGTTCCAGATCCTTGAGG + Intergenic
1014279339 6:119423522-119423544 TTTCTAGTTCCAGATCCTTAAGG - Intergenic
1015215555 6:130746087-130746109 CTTGTAGTCCCAGCTACTTAGGG - Intergenic
1015365238 6:132389757-132389779 TTGGCAGACCCAGATCCTTTTGG - Intronic
1017155380 6:151318198-151318220 CTGGTAGTCCTGGATTCTTCTGG - Intronic
1019862284 7:3670523-3670545 TTATTAGTCTCAGCTTCTTAGGG + Intronic
1020954581 7:14725046-14725068 TTTGTAGTCCCAGCTACCTAGGG + Intronic
1021177030 7:17460925-17460947 TGGGTAGACCCAGTTTCTAATGG + Intergenic
1021806586 7:24362854-24362876 TGGGTAGTCCCAGCTACTTGAGG - Intergenic
1022029909 7:26483035-26483057 TTGCTAGTCCCAAATTATAACGG - Intergenic
1025254104 7:57371644-57371666 TCTGTAGTCCCAGCTTCTCAGGG - Intergenic
1032826747 7:135577592-135577614 TTGGTCATCCCAATTTCTTAAGG + Intronic
1033215647 7:139491530-139491552 TTGCTAGTCCAAGAGTCTTGAGG + Intergenic
1034340191 7:150347821-150347843 GTGGTAGTCCCAGCTGCTTGGGG + Intergenic
1034674212 7:152880806-152880828 TTTCTAGTTCCAGATTCTTGAGG - Intergenic
1034758693 7:153649887-153649909 TTGGTTGTGCCAGAGACTTAAGG + Intergenic
1042531419 8:69819836-69819858 CTTGTAGTCCCAGATACTCAGGG + Intronic
1043668658 8:82852175-82852197 TTGGTAGAATCATATTCTTATGG + Intergenic
1043800712 8:84606132-84606154 TTGGTATTCCCCTATTCCTATGG + Intronic
1044323190 8:90829473-90829495 TTTGGAGTTCCAGATTGTTAGGG + Intronic
1044363846 8:91320184-91320206 CTGGTAGTCCCAGCTACTCAGGG - Intronic
1044570260 8:93710151-93710173 CTTGTAGACCCAGCTTCTTAGGG + Intronic
1046120169 8:109836275-109836297 TTGGTAGCCTGAGATTCTTGAGG + Intergenic
1051085848 9:13348221-13348243 TTTGTAGTCCCAGCTACTCAGGG + Intergenic
1052811877 9:33068413-33068435 TAGGTAGTCCCCAATTCTTAGGG + Intronic
1055299239 9:74865893-74865915 TCTGTAGTCCCAGATTCTCAGGG - Intronic
1055407692 9:75991804-75991826 TTGGTAGTCCCAGATTCTTAAGG - Intronic
1056072461 9:83002070-83002092 TTGGTAAACTTAGATTCTTATGG - Intronic
1056769835 9:89468962-89468984 TAGGTATTACCAGATTCTTATGG - Intronic
1058094710 9:100846558-100846580 ATGGAAGGCCAAGATTCTTAAGG + Intergenic
1058703299 9:107618820-107618842 TCTGTAGTCCCAGATTCTTGGGG - Intergenic
1061352490 9:130076636-130076658 CTGGTAGTCCCAGCTACTCAGGG - Intronic
1203539729 Un_KI270743v1:76727-76749 TTTGTAGTTCCAGATACTTGAGG + Intergenic
1186948180 X:14592546-14592568 TTTGTAGTCCCAGCTACTTAGGG + Intronic
1187733287 X:22278485-22278507 TAGGTATTGCCAGATTCTCAGGG - Intergenic
1187861174 X:23684622-23684644 CTTGTAGTCCCAGCTACTTAGGG - Intronic
1189059451 X:37737655-37737677 CCTGTAGTCCCAGCTTCTTAGGG - Intronic
1190397302 X:49998140-49998162 GCGGGAGTCCCTGATTCTTAGGG - Intronic
1190857835 X:54314643-54314665 TCTGTAGTCCCAGCTACTTAGGG + Intronic
1191645212 X:63472785-63472807 CTTGTAGTCCCAGCTTCTTGGGG - Intergenic
1195511093 X:105716037-105716059 GTGGTAGTCCCACATGCTGAGGG - Intronic
1195698806 X:107686434-107686456 TTGGCAGTCCCAGCTTATCAGGG - Intergenic
1195760120 X:108236739-108236761 TTGGTAGGCCCAGATTGCCAGGG - Intronic
1196817346 X:119675836-119675858 TTGGAAATCACAGATTCTTGGGG + Intronic
1200358470 X:155577453-155577475 CTTGTAGTCCCAGATACTCAGGG + Intronic
1201862513 Y:18615064-18615086 TTGGTGGACCCAGTTTCTAATGG - Intergenic
1201870810 Y:18705316-18705338 TTGGTGGACCCAGTTTCTAATGG + Intergenic