ID: 1055411765

View in Genome Browser
Species Human (GRCh38)
Location 9:76037972-76037994
Sequence AATTACATGCAGCTGGTGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055411765 Original CRISPR AATTACATGCAGCTGGTGCG TGG (reversed) Intronic
903249427 1:22041841-22041863 AAATTCATGCAGCTGGTAGGTGG - Intergenic
903812900 1:26044957-26044979 AATTAAATGAAGTTGGTGCATGG - Intronic
907253022 1:53155794-53155816 AATTGGTTGCAGCTGGTGCCAGG + Intergenic
909609000 1:77533598-77533620 AATGACATGCTGCTGGTCCGTGG + Intronic
911856535 1:102884416-102884438 AATTGGTTGCAGCTGGTGCCAGG + Intronic
916159911 1:161899268-161899290 AATAACTTGCAGCTGTTGCAGGG - Intronic
921740814 1:218682341-218682363 AACTTCATGTAGGTGGTGCGTGG - Intergenic
922760188 1:228124203-228124225 AATTGATTGCAGCTGGTGCCAGG + Intergenic
924453223 1:244198082-244198104 AATTTCAGGCTGCTGGTGGGAGG - Intergenic
1063159072 10:3406753-3406775 ATTTTCACGCAGCTGGTGCTGGG - Intergenic
1064692256 10:17930311-17930333 AAGTTCATGCAGCTAGTGCATGG + Intergenic
1067547384 10:47203598-47203620 ACTTACATGCTGTTGGTGCAAGG - Intergenic
1068941532 10:62685498-62685520 AATTAAATGCAGCTGGAGTTGGG - Intergenic
1070539246 10:77404363-77404385 AATTGCTTGCACCTGGTGGGTGG - Intronic
1070843406 10:79503567-79503589 AATTACAGGAAGATGGTGGGGGG + Intergenic
1070930259 10:80256034-80256056 AATTACAGGAAGATGGTGGGGGG - Intergenic
1071040379 10:81301738-81301760 AATTGCATGCAGCTGGGGTTTGG + Intergenic
1071140227 10:82501108-82501130 AACTATATGGAGCTGGTGAGAGG + Intronic
1074051625 10:109886058-109886080 AATTACAGGGAGCTGGGGAGGGG - Intronic
1074549537 10:114429816-114429838 AATTACATGCAGATTGGGCTGGG + Intergenic
1075221846 10:120591900-120591922 AATAACATGAAGCTGGTGGTAGG + Intergenic
1077101616 11:824976-824998 CAGTGCATGCAGCTGGTGAGTGG - Exonic
1081305077 11:41501928-41501950 AATTGGTTGCAGCTGGTGCCAGG - Intergenic
1081547149 11:44079527-44079549 AATCACATGCAGCCTGTGCCTGG - Exonic
1084574393 11:69979414-69979436 AAGTCCATGCAGCTGGTAAGCGG - Intergenic
1087778275 11:102276664-102276686 AATCACTGGCAGCTGCTGCGTGG - Intergenic
1090564206 11:127968961-127968983 AATTATATGCAACTGATGGGGGG - Intergenic
1090759241 11:129821277-129821299 AATTGCATGGAGCTGTTGAGTGG + Intronic
1092265998 12:6981040-6981062 CACTACATGAAGCTGGTGCAGGG - Exonic
1095275217 12:40274070-40274092 TATTACATGAAGCTGTTGAGGGG + Intronic
1101364394 12:104058277-104058299 ATTTTCATGCAGTTGGTGCCTGG + Intronic
1102690945 12:114760601-114760623 AAGCAAATTCAGCTGGTGCGTGG + Intergenic
1108209117 13:48120440-48120462 AATTACATGCACCTGGAGGCAGG + Intergenic
1111702333 13:91706172-91706194 AATTACATGTAGCTAGGGCCAGG - Intronic
1113104909 13:106761224-106761246 AAGTTCATGGAGCTGGTGAGCGG + Intergenic
1113589889 13:111491114-111491136 AAATGAATGCAGCTGGTGTGAGG - Intergenic
1113880042 13:113619889-113619911 CTTTACCTGCAGCTGGTGTGGGG + Intronic
1114189843 14:20432199-20432221 AATCACATGAAGCTGGAGGGTGG - Intronic
1115123561 14:29966373-29966395 AAATACAAGCATCTGTTGCGAGG + Intronic
1117099775 14:52334375-52334397 AATTGGTTGCAGCTGGTGCCAGG - Intergenic
1117223369 14:53630351-53630373 AGTTACATGCAGGTGGTAGGAGG + Intergenic
1121722327 14:96118308-96118330 AATTGGTTGCAGCTGGTGCCAGG - Intergenic
1202884515 14_KI270722v1_random:92002-92024 ACTTACATGTAGCTCGTGTGTGG + Intergenic
1129043070 15:72707263-72707285 AATCACTTGAACCTGGTGCGGGG - Intronic
1131592788 15:93767877-93767899 AATGTCATGCAGCTGGTACATGG + Intergenic
1132298995 15:100764999-100765021 AATTACAGGCTGCAGGTGAGTGG - Intergenic
1134800961 16:17084152-17084174 AAGGACATGCAGCTGTTGAGTGG - Intergenic
1138262479 16:55635023-55635045 AAATACATGAAGCTGGTGATCGG + Intergenic
1141499783 16:84436040-84436062 AATTGCATGAAGCTGGGGGGTGG + Intronic
1143261371 17:5601164-5601186 AAGATCATGCAGCTGGTGCATGG + Intronic
1146493228 17:33297398-33297420 AATTTCATGGAGGTGGTGGGTGG + Intronic
1146639225 17:34527482-34527504 AAGTACAGGAAGCTGGTGTGGGG - Intergenic
1152372878 17:79901411-79901433 AAGTGCATGCTGCTGGGGCGAGG - Intergenic
1156634242 18:39008672-39008694 AATTGGTTGCAGCTGGTGCCAGG - Intergenic
1162510629 19:11116083-11116105 CAGTACATGAAGCTGGTGGGAGG - Exonic
1202659928 1_KI270708v1_random:59049-59071 ACTTACATGTAGCTCGTGTGTGG + Intergenic
926172137 2:10559133-10559155 ACTGTCATGCAGCTGCTGCGCGG + Intergenic
926394344 2:12425935-12425957 AAGAACCTGCAGCTGGTGTGAGG - Intergenic
928338985 2:30425127-30425149 CATTACATGCAGTGGGTGCTGGG + Intergenic
930479514 2:51928232-51928254 AAATACAGACAGCTGGTGTGTGG - Intergenic
931233186 2:60391434-60391456 AATACCATGCAGCTGCTGCTTGG + Intergenic
935889789 2:107663823-107663845 AATTGGTTGCAGCTGGTGCCAGG + Intergenic
936746481 2:115582461-115582483 AATTGGTTGCAGCTGGTGCCAGG - Intronic
939577096 2:143909012-143909034 AATTGGTTGCAGCTGGTGCCAGG + Intergenic
940111943 2:150164372-150164394 AGTTACATGCACCTGGTACATGG + Intergenic
941158747 2:162010964-162010986 AATTACATTCAACTGGTATGTGG - Intronic
941949696 2:171141393-171141415 AGTTACATGCAGCTAGTGGCTGG + Intronic
944081412 2:195792772-195792794 ATTTACATGCACCTGATGTGGGG + Intronic
944476603 2:200112847-200112869 AATTCATTGCAGCTGGTGCCAGG + Intergenic
946780790 2:223191585-223191607 AAGTACATGCATCAGGTGTGAGG + Intronic
947269476 2:228317988-228318010 AATTACATGCACCTGGGAGGTGG + Intergenic
1170108690 20:12780984-12781006 ACTTATATGCTGCTGGTGGGAGG - Intergenic
1170667857 20:18402258-18402280 AATTGGCTGCAGCTGGTGCCAGG + Intronic
1173167981 20:40699539-40699561 CAATACATGCACCTGGTGCTTGG + Intergenic
1175682719 20:61002653-61002675 AATTGGTTGCAGCTGGTGCCAGG + Intergenic
1175742390 20:61429284-61429306 AAATCCATGCAGCTGGTGAAAGG + Intronic
1180327401 22:11442611-11442633 ACTTACATGTAGCTCGTGTGTGG + Intergenic
1181336750 22:22140827-22140849 AATTGCATGTAGCAGGTGCTTGG - Intergenic
1182100060 22:27651358-27651380 GATCACATGAAGCTGGTGCCAGG - Intergenic
1182280955 22:29217423-29217445 AAGGCCATGCAGCTGGTGTGTGG - Intronic
1184258821 22:43302892-43302914 AATCACATGCAGCTGGGCCTGGG - Intronic
950123630 3:10498231-10498253 AAGGACATGCAGCTGGTCAGCGG + Intronic
955931256 3:64059247-64059269 AATTAGATGCAGCTGGCCAGAGG + Intergenic
957985979 3:87573443-87573465 AAGTATATGCAGCAGGTGTGAGG - Intergenic
959820014 3:110722533-110722555 AATTTCATGGACCTGGTGCATGG - Intergenic
961050553 3:123742133-123742155 AATTAGATGGAGCTGGGGAGAGG - Intronic
964068118 3:152601197-152601219 AAGTACATGCATCAGGTGTGAGG - Intergenic
966218514 3:177527408-177527430 AATTGGTTGCAGCTGGTGCCAGG + Intergenic
969199632 4:5592545-5592567 AATTGGTTGCAGCTGGTGCCAGG + Intronic
970500362 4:16670970-16670992 AATTAGTTACAGCTGGTGTGTGG + Intronic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
976957982 4:90928096-90928118 AAATACATGAAGCATGTGCGGGG - Intronic
977919156 4:102624631-102624653 AATTACATTCTGCTGGTGGAGGG - Intergenic
979465189 4:121029023-121029045 AATTTCATGCAGCTAGTATGGGG - Intergenic
980081850 4:128352326-128352348 AATCACATGTAGTTGGTGCTTGG + Intergenic
986069156 5:4265337-4265359 AATTCCAGGCAGCAGGTGGGAGG + Intergenic
990198014 5:53340825-53340847 AAATGCATGCAGCTGGTAAGTGG - Intergenic
995745203 5:115395177-115395199 AATTGGTTGCAGCTGGTGCCAGG + Intergenic
995966304 5:117911499-117911521 AATTGGTTGCAGCTGGTGCCAGG + Intergenic
996906820 5:128610382-128610404 AATTGGTTGCAGCTGGTGCCAGG - Intronic
998639640 5:143995195-143995217 AAGGACATGCTGCTGGTGAGTGG + Intergenic
1000089637 5:157919147-157919169 AATTAGCTGCAGCTGGTGGCAGG - Intergenic
1000489549 5:161893706-161893728 AATGCCATGCAGCTGGTAGGTGG - Intronic
1006789596 6:36690949-36690971 AAAAACAGGCAGCTGGTGCATGG - Intergenic
1008219273 6:48835964-48835986 AATTGGTTGCAGCTGGTGCCAGG - Intergenic
1009029067 6:58035212-58035234 AACGCCAGGCAGCTGGTGCGAGG + Intergenic
1009204607 6:60786610-60786632 AACGCCAGGCAGCTGGTGCGAGG + Intergenic
1009213686 6:60893960-60893982 AAGTACCTGCAGGTGGTGTGTGG + Intergenic
1010734099 6:79423476-79423498 AATTACACTCAGCTGGGCCGAGG + Intergenic
1013283005 6:108656321-108656343 AAGCACATGCAGCTGGTGTCTGG + Intronic
1022321405 7:29291294-29291316 AATTGGTTGCAGCTGGTGCCAGG - Intronic
1022643872 7:32212897-32212919 AATTTGATGCATCTGGTGTGAGG + Intronic
1026221832 7:68405130-68405152 AATTGGCTGCAGCTGGTGCCAGG - Intergenic
1028549624 7:92045595-92045617 AGGTACATGAAGCTGGTGCTGGG - Intronic
1030414857 7:109230288-109230310 AATTGGTTGCAGCTGGTGCTAGG - Intergenic
1031656115 7:124358047-124358069 AATTACAGGCAATTGGTGCCAGG - Intergenic
1032693268 7:134310873-134310895 ATTTACCTGAAGCTGGTGAGAGG + Intronic
1034732067 7:153396525-153396547 AATTGGCTGCAGCTGGTGCCAGG + Intergenic
1034816234 7:154174179-154174201 AAAGTCATGCAGCTAGTGCGTGG - Intronic
1037927762 8:22857922-22857944 ACTTACATGCCCCTGGTGCATGG + Intronic
1041033237 8:53760097-53760119 AATTGGTTGCAGCTGGTGCCAGG + Intronic
1041670145 8:60483462-60483484 AATTAGTTGCAGCTGGTGCCAGG + Intergenic
1041908942 8:63067332-63067354 AAATACATGCAGCTGGATCCAGG + Intronic
1046463551 8:114572419-114572441 AATTAGTTGCAGCTGGTGCCAGG + Intergenic
1052240872 9:26271930-26271952 AATTGGTTGCAGCTGGTGCCAGG - Intergenic
1052896916 9:33755797-33755819 AATTGCATGGAGCTGTTGAGTGG + Intronic
1053476940 9:38388983-38389005 CAAAACATGCAGCTGGTGCGTGG - Intergenic
1054740994 9:68805581-68805603 GATTCCATACAGCTGGTGTGCGG + Intronic
1055411765 9:76037972-76037994 AATTACATGCAGCTGGTGCGTGG - Intronic
1056889930 9:90482431-90482453 AATCCCATGCTGCTGGTGCCTGG - Intergenic
1057294327 9:93826647-93826669 AATTACATGCAAATGTTCCGCGG - Intergenic
1187751599 X:22471794-22471816 AAATGCAGGCAGCTTGTGCGTGG - Intergenic
1190153615 X:47969041-47969063 AATTACAGTCAGCTGGTGTCTGG + Intronic
1194130744 X:90078989-90079011 AATTACATTCAGATGGTTGGGGG - Intergenic
1199537032 X:148914271-148914293 ACTTAGAGGCAGCTGGGGCGGGG + Intronic