ID: 1055423764

View in Genome Browser
Species Human (GRCh38)
Location 9:76171594-76171616
Sequence CAGAACTTCTTGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 293}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055423764 Original CRISPR CAGAACTTCTTGAGGGCAGA GGG (reversed) Intronic
901776936 1:11566555-11566577 CAGGACTGCTTGAGAGCAGATGG - Intergenic
902872221 1:19321263-19321285 GAGGACTGCTTGAGCGCAGAAGG - Intronic
903756360 1:25664133-25664155 CAGAGCGTGTGGAGGGCAGATGG - Intronic
904180102 1:28660193-28660215 CAGAACTGCTTGAACCCAGAAGG + Intergenic
905235336 1:36542521-36542543 CACAACCCCCTGAGGGCAGATGG - Intergenic
905279156 1:36837809-36837831 CAGAAGCTCTGGATGGCAGATGG + Intronic
905907925 1:41631993-41632015 CTGAACCTCCTGAGGGAAGATGG - Intronic
906544019 1:46608824-46608846 CAGGCCTTCTTGGAGGCAGAGGG + Exonic
906772695 1:48499376-48499398 CACACCTTCATGACGGCAGACGG - Intergenic
907406583 1:54257332-54257354 CAAAACTTCCTTTGGGCAGAGGG + Intronic
909651548 1:77981404-77981426 CAGAACTGCTTGAAGCCAGTAGG - Intronic
910348247 1:86265865-86265887 CAGAAGTCTTTGAGGCCAGAGGG - Intergenic
910736301 1:90461603-90461625 AAGGCCTACTTGAGGGCAGAGGG - Intergenic
914354152 1:146867836-146867858 CAGATCATCTGGAAGGCAGAAGG + Intergenic
914726471 1:150331816-150331838 CTGAACTTCTTTAGGACAGAAGG + Intronic
914873378 1:151493923-151493945 TACACCTTTTTGAGGGCAGAAGG + Intergenic
917213180 1:172651059-172651081 GAGAAACTCTTGAGGGGAGAAGG + Intergenic
918045626 1:180939305-180939327 CTGAAGTTCTGGAGAGCAGATGG - Intronic
919524019 1:198624812-198624834 AGGAAATTCTGGAGGGCAGAGGG + Intergenic
920200242 1:204255804-204255826 GAGAACTCCTCAAGGGCAGAGGG - Intronic
920334709 1:205237228-205237250 CAGAGCTTCTTAAGGGCAATTGG + Intronic
921124352 1:212163642-212163664 CAGAACTTCTTGTGTTCTGAGGG + Intergenic
921141750 1:212314484-212314506 GAGGACTGCTTGAGGCCAGAGGG - Intronic
1062891579 10:1064911-1064933 CAGAAATTGTGGAGGGCATAAGG + Intronic
1063114459 10:3064103-3064125 CAGGACTCCTTTAGGGCACATGG + Intergenic
1063508786 10:6626380-6626402 GAGGACTCCGTGAGGGCAGAGGG - Intergenic
1065130323 10:22613493-22613515 CAGAACTGATGGAGGGAAGATGG + Intronic
1065183066 10:23146052-23146074 CATAACTGGTTGGGGGCAGAGGG - Intergenic
1065875711 10:29995646-29995668 CAGAAATTCTTCAGGGAAGTAGG - Intergenic
1066700646 10:38124280-38124302 CTGAACTTATAGAGGGTAGAAGG + Exonic
1067093960 10:43286220-43286242 CAGCCCTCCTTGAGGGCAGTGGG + Intergenic
1069649856 10:70038400-70038422 GAGAACTGCTTGAGGCCAGGAGG + Intergenic
1069948119 10:72001302-72001324 CAGCTCTGCTTGAGGGCAGCAGG - Intronic
1072867194 10:99076475-99076497 CAGAATTGCTTGAGCACAGAAGG - Intronic
1073884007 10:108016920-108016942 CAGAAATTTTTGAGGGGAGAAGG + Intergenic
1074048719 10:109863339-109863361 CAGAAATTCTGGAGGCCAGAAGG + Intergenic
1074892378 10:117746424-117746446 CAGGACTTCTTCAATGCAGAGGG - Intergenic
1074964942 10:118482562-118482584 CAGCACTTTTGGGGGGCAGATGG - Intergenic
1075351597 10:121729529-121729551 CAGAAATCCTGGAGCGCAGAGGG + Intergenic
1075602535 10:123780987-123781009 TAGTTCTTCTTGAGGTCAGATGG - Intronic
1076700524 10:132270471-132270493 CGGCACTTCTGGAGGGCAGGTGG + Intronic
1077452143 11:2654637-2654659 GAGAGTCTCTTGAGGGCAGAGGG + Intronic
1077647975 11:3943128-3943150 CAAAACATCTAGATGGCAGAAGG - Intronic
1077880313 11:6344083-6344105 CAGCACTTCGGGAGGCCAGACGG + Intergenic
1078095371 11:8293157-8293179 AAGAACACCCTGAGGGCAGAAGG + Intergenic
1078515676 11:12020118-12020140 CAGAATCACTTGGGGGCAGAGGG + Intergenic
1079202732 11:18389344-18389366 CAGAATTGCTTGAGTCCAGAAGG - Intergenic
1079314811 11:19398600-19398622 CAGAAGTTCATGAGAGCAGAGGG - Intronic
1081303160 11:41478199-41478221 GAGAACTGCTTGAGAGCACAAGG - Intergenic
1082654742 11:55840064-55840086 CAGAACTGCTTGAACTCAGAAGG - Intergenic
1084013481 11:66365470-66365492 CAGACCCCCTTGGGGGCAGATGG + Intronic
1084371017 11:68743332-68743354 GAGAATTGCTTGAGGCCAGAAGG - Intronic
1086289289 11:85288567-85288589 CAGAACTGCTTGAACCCAGAAGG + Intronic
1086892835 11:92278109-92278131 CAGAAATTCCTGAGGGGAGGAGG + Intergenic
1087156349 11:94908485-94908507 CAAATCTGCTTGATGGCAGAGGG + Intergenic
1089536530 11:119163698-119163720 CAGAAGTTCTTGAGGACTGGGGG + Intergenic
1092104167 12:5909247-5909269 AAGTACTTGTTGAGGGCAAAAGG - Intronic
1092212805 12:6658772-6658794 CAGAACATCTTCAGAGCAGTAGG - Intronic
1092280966 12:7097370-7097392 CAGAATTGCTTGAGCGCAGGAGG - Intronic
1097645002 12:62226045-62226067 CAAAACTTCTTGAAGGCAATGGG - Intronic
1098209110 12:68144015-68144037 CAGGGCTTCTTTTGGGCAGATGG - Intergenic
1099203867 12:79705970-79705992 CTGAACTTCATGGGGGCAGAGGG + Intergenic
1100251587 12:92830325-92830347 CAGACCTGCTTGAGGGTGGAAGG - Intronic
1101138493 12:101770664-101770686 CAGAGCACCTTGAGAGCAGACGG - Intronic
1101188090 12:102302698-102302720 CAGAATTAATTGAGGCCAGAAGG - Intergenic
1102299140 12:111758422-111758444 CAGCACTTCGGGAGGCCAGATGG + Intronic
1103015065 12:117487837-117487859 CAGAAGCTCTTGAGGTCATACGG - Intronic
1104087965 12:125493313-125493335 GGGAAATTCTGGAGGGCAGAAGG - Intronic
1104089823 12:125506971-125506993 CCAAACTTCTGCAGGGCAGAGGG + Intronic
1108694326 13:52889349-52889371 CGGCACTTCTTGAGGGCAAGAGG + Intergenic
1108807809 13:54181420-54181442 CAGGGCTACTTGTGGGCAGAGGG - Intergenic
1109059619 13:57598056-57598078 GAGAACTGCTTGAGCCCAGAAGG + Intergenic
1109298840 13:60569056-60569078 CAGGACGTCTTGAGCCCAGAAGG - Intronic
1109400391 13:61820104-61820126 CAGAGCTACTTGAGGGTGGAGGG + Intergenic
1110905558 13:80884032-80884054 CAGGACCACTTGAGGGCAGGTGG + Intergenic
1112709910 13:102115669-102115691 GAGAACTGCTTGAGTGGAGAGGG + Intronic
1115050153 14:29050365-29050387 CATAACTTCTGCAGGGTAGAGGG - Intergenic
1115352801 14:32413650-32413672 CATAATGTCTTGAGGACAGAAGG + Intronic
1116819162 14:49610964-49610986 CTGAACTTTTTTAGGGGAGAGGG + Intronic
1118141085 14:63083829-63083851 CAGAAACTCTGGAGGCCAGAAGG + Intronic
1118194105 14:63608752-63608774 CTCAACTTCTTAAAGGCAGAAGG - Intronic
1118405518 14:65419770-65419792 CTGAAATTCTTGAGGCCAAAAGG + Intronic
1118890042 14:69901468-69901490 CAGAACTACATGAAGGCTGAGGG - Intronic
1118982601 14:70728859-70728881 CAGAGAGTCTTGAGGGAAGAGGG + Intronic
1119508243 14:75191221-75191243 CAGAGCTTTAGGAGGGCAGAAGG + Intergenic
1119764405 14:77179348-77179370 GAGGACTTCTTGAGGCCAGGAGG - Intronic
1120231614 14:81846675-81846697 GAGATCTCCTTGAGGGAAGATGG + Intergenic
1121205823 14:92166434-92166456 GAGGACTGCTTGAGGCCAGAAGG - Exonic
1123692178 15:22847552-22847574 GAGAACTGCTTGAAGCCAGAAGG - Intronic
1123794794 15:23760850-23760872 CAGAATCTCCTGAGGGCAGAGGG - Intergenic
1124354016 15:28981988-28982010 AAGGACTACTAGAGGGCAGAGGG + Intronic
1124948913 15:34298094-34298116 CTGAACTTCTTGAGAGCAAATGG - Intronic
1125765764 15:42134844-42134866 GAGAACTGCTTGAGCCCAGAAGG - Intergenic
1126655029 15:50967900-50967922 CAGAACTGCTTGAACCCAGAAGG - Intronic
1126890782 15:53201971-53201993 CAGAAATTCTGGAGGTCATATGG + Intergenic
1127047906 15:55046738-55046760 GAGACCTTCTTGAGCTCAGAAGG - Intergenic
1128744411 15:70103451-70103473 CAGAAGTTGTGGTGGGCAGAGGG + Intergenic
1132860235 16:2067384-2067406 GAGAACTGCTTGAGGCCAGGAGG - Intronic
1134780715 16:16892728-16892750 CAGAACATGTTAAGGACAGAAGG - Intergenic
1135249521 16:20889133-20889155 CAGAACTGCTTGAGCCCAGGAGG + Intronic
1135600010 16:23775026-23775048 CAGAAATCCTTCAGCGCAGATGG + Intergenic
1135973239 16:27087542-27087564 GAGAACTTCTTGAATGCAGGAGG + Intergenic
1136003329 16:27312646-27312668 GAGAGCTCCTTGAGGGCAGCAGG + Intergenic
1137690032 16:50419323-50419345 CAGAAATTATGGAGGCCAGAAGG - Intergenic
1137891419 16:52166606-52166628 TAAAACCTCCTGAGGGCAGATGG + Intergenic
1137920803 16:52486476-52486498 CACAACTCCTGGAGGGCAGCTGG - Intronic
1138720974 16:59078644-59078666 GGGATCTACTTGAGGGCAGAGGG - Intergenic
1138726553 16:59146829-59146851 CAGATATTCTAGAGGGCAGTGGG - Intergenic
1139979865 16:70847701-70847723 CAGATCATCTGGAAGGCAGAAGG - Intronic
1140056466 16:71530178-71530200 CAGAACTTCTTTCAGGGAGAAGG + Intronic
1140913879 16:79477812-79477834 GAGAACTTCTTGAGCCCAGGAGG - Intergenic
1141017587 16:80465105-80465127 CTGAGCTTCTTGAGGGCATCTGG - Intergenic
1141247540 16:82323760-82323782 GAGAACTGCTTGAGCCCAGAAGG - Intergenic
1141346736 16:83253501-83253523 CAGACCTGCTTAATGGCAGAAGG - Intronic
1141652017 16:85397790-85397812 CAGACCTTCAGGAGGGCAGCAGG - Intergenic
1142287585 16:89177663-89177685 CTGAACTTGGTGAGGGCAGCAGG - Intronic
1142666785 17:1467902-1467924 CAGAGATTCCTGAGGGGAGAGGG + Exonic
1143712646 17:8744946-8744968 CAGAAGTTCCTGAGGGCAAAGGG - Intronic
1144493706 17:15734456-15734478 CACAACTGCCTGAGGGCAGAGGG - Intronic
1144685440 17:17223059-17223081 CTGTGCTTCTGGAGGGCAGAAGG + Intronic
1144713786 17:17420570-17420592 CAGAACTTCCTGAGGCTTGACGG + Intergenic
1144906559 17:18642223-18642245 CACAACTGCCTGAGGGCAGAGGG + Exonic
1145076451 17:19858878-19858900 GAGAACTGCTTGAGCCCAGAAGG + Intronic
1146661833 17:34669968-34669990 CAGGACTTCTTCAGAACAGAGGG - Intergenic
1148675192 17:49440796-49440818 CAGGACTTCCTGAGTCCAGATGG - Intronic
1149052410 17:52322286-52322308 AAGAACTTCTTGAAGACTGAAGG + Intergenic
1149288824 17:55195767-55195789 GTAAACTTCTTGAGGGCAGGGGG + Intergenic
1149904835 17:60516071-60516093 CAGAACTGCTTGAACCCAGAAGG + Intronic
1152288258 17:79424656-79424678 CAGACCTGCCTGAGGCCAGAGGG - Intronic
1153887111 18:9476362-9476384 CAGAATTACTTCAGGGAAGACGG - Intronic
1155236296 18:23822874-23822896 GAGGAATTCCTGAGGGCAGAGGG + Intronic
1156030184 18:32704269-32704291 CCCAAGTTATTGAGGGCAGAAGG + Intronic
1156590636 18:38483957-38483979 CAGCACTGCTTTAAGGCAGATGG - Intergenic
1159861109 18:73650803-73650825 CTAAGCTTCTTGAGGGCAGGTGG - Intergenic
1159973099 18:74677436-74677458 AAGAATATTTTGAGGGCAGAAGG - Intronic
1161703697 19:5807991-5808013 GAGAACTTCTTGAGCCCAGGAGG + Intergenic
1162038843 19:7957216-7957238 CAGAATTGCTTGAGCCCAGAAGG + Intergenic
1163303480 19:16462576-16462598 CAGAATTGCTTGAGCCCAGATGG + Intronic
1164442634 19:28291152-28291174 CAGAACCTCCTAGGGGCAGATGG - Intergenic
1164757087 19:30697810-30697832 GAAAACTTCTGGAGGGCATATGG - Intronic
1165935091 19:39384260-39384282 CTGAACTTTATGAGGGGAGAGGG + Exonic
1166353763 19:42215163-42215185 CAGAACTGCTTGACTGCCGACGG + Exonic
1168521118 19:57051288-57051310 CAGAAGTTCTGGAAGGTAGAGGG - Intergenic
925740140 2:6998469-6998491 CAGCCTTTCTTAAGGGCAGAAGG + Intronic
926748171 2:16177229-16177251 GAGAACTTCTTGATGCCAGGAGG - Intergenic
926838544 2:17051942-17051964 CATAACTGCTTGCGGGGAGATGG + Intergenic
927798507 2:26074506-26074528 GAGAACTGCTTGAACGCAGAAGG - Intronic
929910076 2:46082357-46082379 CAGGACTTGGTGAGGGCTGAGGG + Intronic
930461999 2:51693160-51693182 CAGAGCTTCTTGAGGGTGGAGGG + Intergenic
930672150 2:54162715-54162737 CAGCACTTTTGGAGGCCAGAGGG + Intronic
931562463 2:63577055-63577077 TAGAACTTCTTGATTGCAAAGGG - Intronic
933974376 2:87496790-87496812 CAGGACTTGCTGAGGGCAGGGGG - Intergenic
934081232 2:88469263-88469285 CAAAACCTCTTCAGGGCAGAGGG + Intergenic
935601173 2:104922954-104922976 CAGAAATTCTGGAGGCCAGAAGG + Intergenic
936319448 2:111454029-111454051 CAGGACTTGCTGAGGGCAGGGGG + Intergenic
938836641 2:135110221-135110243 GAGAACTGCTTGAGGCCAGGAGG - Intronic
939274504 2:139983699-139983721 TGGACCTACTTGAGGGCAGAGGG - Intergenic
939908738 2:147952718-147952740 CTGAACTTCTTGAGAGCAGTCGG - Intronic
939987729 2:148848168-148848190 CAGAAACTCTGGAGGACAGAAGG - Intergenic
940769576 2:157825802-157825824 CAGAGCATCTTGAGTGAAGAGGG + Intronic
942051132 2:172142036-172142058 CAGCAATTGTTGAGAGCAGAGGG + Intergenic
943741045 2:191409439-191409461 CTGAACTACTTGAGAGCAGCTGG - Intronic
944649423 2:201814493-201814515 CATATCTTCTTGAGGGGAGAGGG - Intronic
944918227 2:204383323-204383345 GAGAACTTCTTGAACCCAGAAGG - Intergenic
945308222 2:208280649-208280671 CAGAACTCCTTGAATGAAGAGGG - Intronic
946117859 2:217479324-217479346 CAGAAGCTCTTGATGGCTGAGGG + Intronic
946174702 2:217915429-217915451 CAGTGCTTCTTGAAGACAGACGG - Intronic
947284167 2:228493106-228493128 GAGAATTTCTTGAGCCCAGAAGG + Intergenic
947775459 2:232705496-232705518 CAGAACTGCTTGAGCCCAGGAGG - Intronic
948093106 2:235312324-235312346 TAGAACTGCTTGAGCCCAGAAGG + Intergenic
948925382 2:241093164-241093186 CAGACCCACTTGAGAGCAGAAGG + Exonic
1170075905 20:12418736-12418758 CAGATCTACTTGAGGGAGGAAGG + Intergenic
1170247625 20:14240678-14240700 CAGGCCTACTTGAGGGCAGAAGG + Intronic
1170426663 20:16241927-16241949 CAGCACTTCTTAACAGCAGAAGG - Intergenic
1171003695 20:21441606-21441628 CAGAACTGCTTGAACCCAGAAGG + Intergenic
1171289009 20:23969486-23969508 CAGAACTCATTGAGGCCAGAGGG + Intergenic
1171753227 20:29076155-29076177 CAGGACTACTAGAGGGGAGAAGG - Intergenic
1171789027 20:29501405-29501427 CAGGACTACTAGAGGGGAGAAGG + Intergenic
1171858501 20:30373093-30373115 CAGGACTACTAGAGGGGAGAAGG - Intergenic
1173469027 20:43308323-43308345 CTGAACTTCTTAAGGGGAGGAGG + Intergenic
1175275568 20:57767813-57767835 CAGAAATTATGGAGGCCAGAAGG - Intergenic
1175444512 20:59010752-59010774 CAGTGGTGCTTGAGGGCAGAGGG + Intergenic
1177801269 21:25831135-25831157 CAGAACTGCTTGAGCCCAGGAGG + Intergenic
1179889924 21:44330318-44330340 CAGGACGTTCTGAGGGCAGAGGG + Exonic
1179897706 21:44371785-44371807 CAGAAATCTTTGAGGTCAGAGGG - Intronic
1180008294 21:45033319-45033341 TAGAATTTCTCCAGGGCAGAAGG + Intergenic
1182159777 22:28110024-28110046 CAGAACTTGTGGTGGGCAGCAGG + Intronic
1184463090 22:44651014-44651036 AAGAACTTCTAGAGGGCTGAAGG + Intergenic
1184829794 22:46977416-46977438 CTGAGCTTCTTGGGGACAGAGGG - Intronic
950468876 3:13172584-13172606 CAACACTTCCCGAGGGCAGATGG + Intergenic
951586761 3:24222632-24222654 CCAAATTCCTTGAGGGCAGAAGG - Intronic
952701804 3:36336384-36336406 CAGTATTTCTTCAGGTCAGAAGG - Intergenic
953766186 3:45745717-45745739 CAAAACTTCATCATGGCAGAAGG - Intergenic
954794340 3:53153989-53154011 CAGAACATCGTGTGTGCAGAAGG + Intergenic
955595567 3:60586831-60586853 GGGACCTGCTTGAGGGCAGAGGG + Intronic
956704469 3:71987577-71987599 GAGGACTGCTTGAGGCCAGAAGG - Intergenic
957223343 3:77412455-77412477 CAGTAGATCTTGAGGACAGAGGG - Intronic
958010445 3:87871724-87871746 CAGAAATTCTATAGGCCAGAAGG + Intergenic
958712677 3:97737139-97737161 CTGGACTTCTTTAGGGAAGATGG - Intronic
959314813 3:104789681-104789703 CAGAACATGTTGAGGTCAAAAGG + Intergenic
959796282 3:110432421-110432443 CGGGACTTCTAGAGGGGAGAGGG - Intergenic
960965858 3:123104296-123104318 CTGGAGTTCTTCAGGGCAGAGGG + Intronic
965122668 3:164582776-164582798 CAGGATTTCTTGAGGCCAGAAGG + Intergenic
965636879 3:170791328-170791350 CAGAACTTATTTAGGGGAAAAGG + Intronic
966778298 3:183562042-183562064 CACTACTTGTTGAGGGTAGACGG - Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
968971564 4:3798306-3798328 CAGAAGTTCTTGGAGGCAGCGGG + Intergenic
969041349 4:4298514-4298536 GAGGACTGCTTGAGGCCAGAAGG - Intronic
969328928 4:6461767-6461789 CAGCACTTTCTGAGGGAAGAGGG - Intronic
970425671 4:15943881-15943903 GAGAACTGCTTGAAGCCAGAAGG - Intergenic
971076022 4:23151016-23151038 CAGAAATACTTTGGGGCAGAGGG + Intergenic
971188712 4:24406254-24406276 CCTAACTTCTTGTGGGAAGATGG - Intergenic
971965471 4:33549906-33549928 CAGACATTTTTGAGGACAGAAGG + Intergenic
972008378 4:34141142-34141164 GAGAACTGCTTGAAGGCAGGAGG + Intergenic
973566048 4:52188657-52188679 CAGGGCTACCTGAGGGCAGAGGG - Intergenic
975130687 4:70829713-70829735 CAGGACTGCTTGAGCCCAGAAGG + Intronic
975874014 4:78814173-78814195 GAGTAATTCTTGAGGACAGAGGG - Intronic
976036288 4:80825558-80825580 CAGAAACTTTTGAGGTCAGAAGG + Intronic
976164215 4:82236820-82236842 AAAAACTTGTCGAGGGCAGAAGG + Intergenic
976535585 4:86211392-86211414 CAGAAACTTTGGAGGGCAGAAGG + Intronic
976802719 4:89010719-89010741 CAGAACCACATGATGGCAGAGGG - Intronic
977607835 4:98999972-98999994 AAGAATTTTTTGAGGACAGAGGG + Intronic
977734743 4:100399916-100399938 TGGGACTTCTTGAGGGTAGAGGG - Intronic
978230764 4:106395761-106395783 CAGAAATTTTGGAGGCCAGAAGG - Intergenic
979673434 4:123385131-123385153 CAGCACTTTTTGAGGGCAGGGGG + Intergenic
981160729 4:141495636-141495658 TAGAACTCTTTGAGGGCATAGGG - Intergenic
982272432 4:153604949-153604971 CAGCACTTCTGGAGGCCAAAGGG - Intronic
982565916 4:156986521-156986543 CAGAGCTGCTTGAGGTCAGACGG - Intergenic
984499944 4:180546372-180546394 CAGAACTGCTTGAGGGAACACGG - Intergenic
986566147 5:9116666-9116688 CAGGATTTCTTGAGGGTTGATGG + Intronic
987075661 5:14379830-14379852 CAGAACGGCTGGAAGGCAGATGG - Intronic
987087155 5:14481455-14481477 CAGAACTTCATCAGGTCAGAGGG + Intronic
987943234 5:24569850-24569872 CAGAATTTCTTGAACGCAGGAGG - Intronic
988497319 5:31756483-31756505 CAGGACTTCTTGTGGGCCCAAGG - Intronic
988709238 5:33756833-33756855 CAGCACTGTTTTAGGGCAGAGGG - Intronic
991010759 5:61880797-61880819 CAAAAGATCTTGAGGGCAAAGGG + Intergenic
991017408 5:61946557-61946579 CAGAACTTGGAGAGGGAAGATGG + Intergenic
991593661 5:68280101-68280123 CAGAATGTGTTGAGGGAAGATGG + Intronic
991655424 5:68899324-68899346 CAGCGCTACTTGAGAGCAGATGG + Intergenic
991727086 5:69546391-69546413 CAAAAACTCTTGAGGGGAGAGGG - Intronic
991867871 5:71081483-71081505 CAAAAACTCTTGAGGGGAGAGGG + Intergenic
992002159 5:72446358-72446380 CAGACATCCTAGAGGGCAGATGG + Intronic
993336649 5:86667905-86667927 CAGAAGTTCTAAAGGGCATATGG - Intergenic
995978443 5:118071917-118071939 AAGAACTTCTGAAGGGCACAGGG + Intergenic
997417240 5:133738576-133738598 CAGAAGTTCTTTGGGTCAGAAGG - Intergenic
997647744 5:135492139-135492161 CAGGCATTCTTGAGAGCAGAGGG - Intergenic
998031653 5:138875233-138875255 CTTAACTTGTTGATGGCAGATGG + Exonic
999248819 5:150169478-150169500 CTGACCTTCTTGAAGCCAGAAGG + Intronic
999511817 5:152260110-152260132 CAGAACTTTGTCAGAGCAGATGG - Intergenic
1001249518 5:170136026-170136048 CAGAACTCCTTGGGGGCATGTGG + Intergenic
1001457780 5:171878698-171878720 CAGAATTGCTTGAGCCCAGAAGG + Intronic
1001587865 5:172845386-172845408 CAGCACTTCCTGTGGGCAGCGGG + Intronic
1001779982 5:174359999-174360021 CAGTACGATTTGAGGGCAGAGGG + Intergenic
1005687198 6:28266057-28266079 AAGGACTTCTTGAGGGTGGAGGG - Intergenic
1005785112 6:29237005-29237027 CAGATTTTCTTGAGGGTGGAAGG - Intergenic
1005811368 6:29518784-29518806 CACAACTATTCGAGGGCAGAGGG - Intergenic
1005870981 6:29974498-29974520 GAGAACTTGCTGAGGGCCGAAGG + Intergenic
1005931648 6:30489489-30489511 GAGAACTTCTTGAGTCCGGATGG - Exonic
1006454512 6:34124123-34124145 CTGATCTTCTTGCTGGCAGAGGG - Intronic
1006858114 6:37150274-37150296 CAGAACAGTTTGAGGGCAGCTGG + Intergenic
1007610564 6:43146286-43146308 CAGGAATCTTTGAGGGCAGAGGG + Intronic
1007680950 6:43633070-43633092 GAGAATTGCTTAAGGGCAGAGGG - Intronic
1011474862 6:87741490-87741512 CAGAACTCCTGGGGGGGAGATGG + Intergenic
1011764560 6:90606188-90606210 CAGAATAACTTGAGGGTAGATGG - Intergenic
1013079129 6:106797161-106797183 CAGGACTGCTTGAGGAAAGAGGG + Intergenic
1013729270 6:113144249-113144271 CAGAACTTCTTGGGGGCTTAAGG - Intergenic
1014018055 6:116557025-116557047 GAGAACTTCTTGAACCCAGAAGG - Intronic
1016317421 6:142805929-142805951 CACAATTTCTGCAGGGCAGACGG - Intronic
1016546739 6:145232493-145232515 GAGAACTACTTGAGGGCAGAGGG - Intergenic
1016557155 6:145351673-145351695 GAGAGTTGCTTGAGGGCAGAGGG + Intergenic
1016933639 6:149432376-149432398 CTTAACTTCTGGAAGGCAGAGGG - Intergenic
1018148953 6:160920710-160920732 AAAAACTCCCTGAGGGCAGAGGG - Intergenic
1023991938 7:45133703-45133725 CAGACCATGATGAGGGCAGAGGG - Intergenic
1024379787 7:48683242-48683264 CATAAATTCTTGAGGGGAGGAGG + Intergenic
1025818940 7:64945580-64945602 GGGACCTTCCTGAGGGCAGAGGG - Intergenic
1028186859 7:87796614-87796636 AAGAAATTCTGGAGGCCAGAAGG + Intronic
1028617728 7:92788780-92788802 CAGAAACTATGGAGGGCAGAAGG + Intronic
1029028847 7:97447733-97447755 ATGAAGTTCTTTAGGGCAGATGG - Intergenic
1029811995 7:103058525-103058547 CAGAAGTGCTAGAGAGCAGATGG - Intronic
1032483762 7:132267426-132267448 CAGAACTGCTCTAGGGCTGAGGG - Intronic
1033769041 7:144527924-144527946 CGGGCCTACTTGAGGGCAGAGGG + Intronic
1034269773 7:149797875-149797897 CTGAGCTCCTTGAGGGCAGTGGG + Intergenic
1034893675 7:154861207-154861229 AAAAACTACTTGAGGACAGATGG - Intronic
1035876671 8:3197020-3197042 CCACACTTCTTGAGAGCAGAAGG - Intronic
1037340529 8:17839755-17839777 CAAAGCTCCTTGATGGCAGAGGG - Intergenic
1037543905 8:19899174-19899196 CGGAACTTTTAGAGGGCAAAGGG - Intergenic
1037710452 8:21351278-21351300 CAGAACTTCTTGAGGAGCCACGG - Intergenic
1038709839 8:29933284-29933306 CAGAACTTTGGGAGGGCCGAGGG - Intergenic
1038760342 8:30379959-30379981 AAGAAGTTATTGAGGCCAGAGGG - Intergenic
1038825485 8:30995217-30995239 AATATCTTCATGAGGGCAGAGGG - Intergenic
1039909760 8:41816652-41816674 GAGGACTGCTTGAGGTCAGAAGG - Intronic
1040775734 8:51041379-51041401 GAGAACTGCTTGAGGTCAGGAGG - Intergenic
1041394034 8:57373753-57373775 CAGAACTTCTGGAGGCCTGTGGG + Intergenic
1041576347 8:59400207-59400229 CAGAAATTTTTGAGGCCAGAAGG + Intergenic
1046098663 8:109589565-109589587 CAGAACTTCTGGAGGCCACTGGG - Intronic
1046752003 8:117936030-117936052 CAGAGCTTTTTGTGGGCTGATGG - Intronic
1047406910 8:124593147-124593169 CAGAACTTGGAGAGCGCAGAAGG - Intronic
1047628557 8:126681338-126681360 GAGAACAACTTGAGGGCTGAAGG - Intergenic
1049127950 8:140809714-140809736 GAGAACTGCTTGAGCCCAGATGG + Intronic
1049163450 8:141112107-141112129 CAGCACGTCTTGAGGGCACTGGG + Intergenic
1049529948 8:143149128-143149150 CAGAAATGCTCCAGGGCAGAGGG + Intergenic
1050019766 9:1270720-1270742 CAGAATCTCCTAAGGGCAGAAGG - Intergenic
1055423764 9:76171594-76171616 CAGAACTTCTTGAGGGCAGAGGG - Intronic
1055715521 9:79113522-79113544 CAGAAATTCATGGGGACAGAGGG - Intergenic
1057239387 9:93394919-93394941 CAGAAATTTTGGAGGCCAGAAGG - Intergenic
1057506751 9:95640338-95640360 CAGTACTTTATGATGGCAGATGG + Intergenic
1057638612 9:96795799-96795821 CAGAAATTTTGGAGGCCAGAAGG + Intergenic
1058680744 9:107438330-107438352 CAGCACTGCTTGGTGGCAGAGGG - Intergenic
1059792377 9:117654075-117654097 CAGAAGTTCCTGAGGGAACACGG - Intergenic
1059821494 9:117978300-117978322 GATAACTTCTTGAGAGAAGAGGG + Intergenic
1062123434 9:134846651-134846673 CAGAACTCCTTGGGGCCAGTGGG - Intergenic
1186319435 X:8408096-8408118 AAGTACGTCTAGAGGGCAGATGG - Intergenic
1188387466 X:29578667-29578689 AAGAAATTCTTGAGGGCTGAGGG - Intronic
1188455317 X:30357692-30357714 GAGAACTTCTTCAGAGTAGAGGG + Intergenic
1191627102 X:63281267-63281289 CAATACTTCTTCAGGTCAGAAGG + Intergenic
1192224109 X:69216692-69216714 CAGGACTTCTGGTGGGCACATGG + Intergenic
1193433529 X:81442264-81442286 CAGAATTGCTTGAGCCCAGATGG - Intergenic
1193747647 X:85301309-85301331 CAGAAATTATAGAGGCCAGAAGG + Intronic
1195907897 X:109863564-109863586 TAGAACTTCTTCAGGGAAGTAGG - Intergenic
1196102058 X:111856724-111856746 GAGAATCACTTGAGGGCAGAAGG + Intronic
1197072957 X:122322325-122322347 CAGAACTTCTTATGGACTGATGG + Intergenic
1200843275 Y:7805451-7805473 CAGTATTACTTGTGGGCAGAGGG + Intergenic