ID: 1055431142

View in Genome Browser
Species Human (GRCh38)
Location 9:76245440-76245462
Sequence GGCACTGAAGTGTTCAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055431137_1055431142 10 Left 1055431137 9:76245407-76245429 CCAAAAGGATTTTTTAAAAAAAG 0: 1
1: 3
2: 20
3: 281
4: 1897
Right 1055431142 9:76245440-76245462 GGCACTGAAGTGTTCAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055431142 Original CRISPR GGCACTGAAGTGTTCAAGGA AGG Intronic
No off target data available for this crispr