ID: 1055432397

View in Genome Browser
Species Human (GRCh38)
Location 9:76257543-76257565
Sequence GTCTCTCTGCACCTCCCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055432394_1055432397 -1 Left 1055432394 9:76257521-76257543 CCAGACTCATCCTTTCCACAAAG 0: 1
1: 0
2: 0
3: 19
4: 224
Right 1055432397 9:76257543-76257565 GTCTCTCTGCACCTCCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055432397 Original CRISPR GTCTCTCTGCACCTCCCACC AGG Intronic
No off target data available for this crispr