ID: 1055432475

View in Genome Browser
Species Human (GRCh38)
Location 9:76258041-76258063
Sequence TTTCCACAGCTCCCAGGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055432470_1055432475 4 Left 1055432470 9:76258014-76258036 CCAAGGATGTCTACCTCTCAGCT 0: 1
1: 0
2: 1
3: 28
4: 223
Right 1055432475 9:76258041-76258063 TTTCCACAGCTCCCAGGTACAGG No data
1055432471_1055432475 -9 Left 1055432471 9:76258027-76258049 CCTCTCAGCTCCCTTTTCCACAG 0: 1
1: 0
2: 3
3: 27
4: 441
Right 1055432475 9:76258041-76258063 TTTCCACAGCTCCCAGGTACAGG No data
1055432469_1055432475 5 Left 1055432469 9:76258013-76258035 CCCAAGGATGTCTACCTCTCAGC 0: 1
1: 0
2: 2
3: 13
4: 126
Right 1055432475 9:76258041-76258063 TTTCCACAGCTCCCAGGTACAGG No data
1055432468_1055432475 17 Left 1055432468 9:76258001-76258023 CCAGGCAGGTAACCCAAGGATGT 0: 1
1: 0
2: 3
3: 8
4: 108
Right 1055432475 9:76258041-76258063 TTTCCACAGCTCCCAGGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055432475 Original CRISPR TTTCCACAGCTCCCAGGTAC AGG Intronic
No off target data available for this crispr