ID: 1055433906

View in Genome Browser
Species Human (GRCh38)
Location 9:76272881-76272903
Sequence TTGGAGAAGCAAGAAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 601
Summary {0: 1, 1: 0, 2: 4, 3: 62, 4: 534}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055433906_1055433912 29 Left 1055433906 9:76272881-76272903 CCTGCCTCTTCTTGCTTCTCCAA 0: 1
1: 0
2: 4
3: 62
4: 534
Right 1055433912 9:76272933-76272955 AAACTCTTTGCAATCTACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055433906 Original CRISPR TTGGAGAAGCAAGAAGAGGC AGG (reversed) Intronic
900002999 1:25264-25286 TTGCAGAGGAAAAAAGAGGCTGG + Intergenic
900022719 1:195789-195811 TTGCAGAGGAAAAAAGAGGCTGG + Intergenic
900810572 1:4798569-4798591 TTGGACAGGCAGGAAGAGGAGGG - Intergenic
901335777 1:8447826-8447848 TCGGAGAAGCAGGCAGAGCCTGG - Intronic
901431249 1:9216345-9216367 GTGGAGAAGGAAGAAGACACAGG - Intergenic
902533344 1:17104727-17104749 TTGAAAAGGCAAAAAGAGGCCGG - Intronic
902556742 1:17251190-17251212 TCTGAGAAGCCAGCAGAGGCTGG + Intronic
902990573 1:20184855-20184877 ATTGAGAAGAAAGGAGAGGCTGG + Intergenic
903747526 1:25598137-25598159 CTGTAGCAGCAAGAAGAGGCAGG + Intergenic
903841561 1:26245401-26245423 TAGGAAAGGCAAGAGGAGGCAGG - Intronic
904250891 1:29223491-29223513 TTTGAGCAGGAAGAAGAGGTAGG + Intronic
904500428 1:30909601-30909623 TTGGAGAAGTAAGAACAGCATGG - Intergenic
904635008 1:31873149-31873171 TGGGGGAAGTAAGAAGTGGCTGG + Intergenic
905388507 1:37621207-37621229 TTGGAGAGGGAAGCAGGGGCTGG + Intronic
905489356 1:38331605-38331627 TAGGAGAAGCTATAAGAAGCAGG + Intergenic
905828370 1:41044729-41044751 TTGGTGAGGCAAGAAGAGTCTGG + Intronic
906096559 1:43228167-43228189 CTGGAGAGGCAGGGAGAGGCTGG - Intronic
906196900 1:43935252-43935274 CTGGAGATGCCAGAAGTGGCTGG - Intronic
906673918 1:47679500-47679522 TTGGAGACACAGGAAGAGGCAGG - Intergenic
907190741 1:52645928-52645950 TTGGAAAACAAAGAAGAGGAGGG + Intronic
907765935 1:57410500-57410522 TTGGAAAGGCAGGCAGAGGCAGG + Intronic
908088348 1:60660631-60660653 TTGGAGAACAAAGAGGAGTCTGG - Intergenic
908226246 1:62059046-62059068 TTAGAGAAGAATGAAAAGGCAGG - Intronic
908909474 1:69056393-69056415 TTGAAGAAGTAAAAAGGGGCCGG + Intergenic
909851348 1:80468025-80468047 TTAAAGAAGAAAGAAGAGGCTGG - Intergenic
910707576 1:90146354-90146376 TTAGAAAAGGAAAAAGAGGCCGG + Intergenic
910909281 1:92216626-92216648 TTGGGTAAGCAAGAAGAGATGGG + Intergenic
911064801 1:93778662-93778684 TTGGAGGAGCCAGAACTGGCAGG - Intronic
911108561 1:94158886-94158908 CTTAAGAAGCAAGAAGAGGCTGG - Intronic
911701054 1:100952024-100952046 TTGAAGATGGAGGAAGAGGCCGG + Intronic
912250544 1:108007976-108007998 TTGGAGGAGGAGGAAGAGGTAGG + Intergenic
912616621 1:111107415-111107437 CTAGACAAGCAAGAACAGGCTGG - Intergenic
912798969 1:112709372-112709394 CTGGAGAAGGAAGCAGTGGCTGG + Intronic
912968339 1:114257036-114257058 TTGGAGGAGCATACAGAGGCAGG - Intergenic
913053194 1:115134705-115134727 TGGGAGCAGCACGCAGAGGCTGG - Intergenic
915135756 1:153730125-153730147 TTTGTGAATCAAGAAGTGGCTGG + Intronic
916102008 1:161400684-161400706 TTGGAAAATTAAGAAGAGGCCGG + Intergenic
916493645 1:165325941-165325963 TGGGGGAAGGAAGAGGAGGCAGG - Intronic
917418390 1:174835632-174835654 TTTTAGAAGCCAGAGGAGGCTGG - Intronic
917526066 1:175789563-175789585 TTGAAGAAGAAAGCAGAGACTGG - Intergenic
918069049 1:181121722-181121744 TAGGAGAGGCCAGAGGAGGCAGG - Intergenic
918309102 1:183272844-183272866 TTGGAGAAGATATGAGAGGCTGG + Intronic
918584493 1:186170187-186170209 GTGGAGAAACAATAAGATGCTGG + Intronic
920205102 1:204285820-204285842 TTGGAGAAGGAAGAAGAGTTGGG + Intronic
920416482 1:205802129-205802151 TTGGAGAGGGAGGAGGAGGCAGG + Intronic
920851374 1:209630384-209630406 CTGGAGAGGCCAGAAGAAGCAGG + Intronic
921148689 1:212382990-212383012 TTGGAAAAGGAAGAAGGGGAAGG - Intronic
921280048 1:213557462-213557484 CTGGAGAGGGAAGAAGAGGCAGG + Intergenic
921401749 1:214731455-214731477 TTGGAAAAAGAAGAAGAGGCCGG - Intergenic
923495584 1:234521719-234521741 ATGGAGAAGCAGCAAGGGGCAGG - Intergenic
1063191624 10:3700046-3700068 TTGGAGACGCCTGATGAGGCTGG - Intergenic
1064420562 10:15187031-15187053 CAGGAGTAGCAAGGAGAGGCAGG + Intergenic
1064533789 10:16337034-16337056 TTGGATAACCAAGAAGAAACAGG - Intergenic
1065557168 10:26928136-26928158 TAAGAGTAGTAAGAAGAGGCCGG + Intergenic
1066597652 10:37069126-37069148 TTGGAGAAGCAAAAAAGGACAGG - Intergenic
1067088207 10:43253869-43253891 TTGCAGCAGCAATAAGAGGCAGG + Intronic
1067785252 10:49241156-49241178 TTGGGGAAGTCAGGAGAGGCCGG - Intergenic
1067875650 10:50005313-50005335 TTAAAGAAGCAATAAGAGGCTGG + Intronic
1067878384 10:50024073-50024095 TGGGAGAAGGAAAAAGAGGGTGG - Intergenic
1067893338 10:50153855-50153877 TGGGAGAAGGAAAAAGAGGGTGG + Intergenic
1068044674 10:51871367-51871389 TGGGGGAAGCAAGAAGACGTGGG - Intronic
1069053722 10:63821795-63821817 TGTGAGAAGCAGAAAGAGGCAGG - Intergenic
1070105314 10:73425852-73425874 TGGGAGGAGCAAGTAGAGACCGG - Exonic
1070480828 10:76881172-76881194 ATGAAGAAGCAAGGAGATGCGGG + Intronic
1070497439 10:77037570-77037592 GTGGAAAAGCAAGAAGGGCCTGG + Intronic
1070653629 10:78255702-78255724 ATGGAAAAGCAGTAAGAGGCTGG - Intergenic
1070813423 10:79309663-79309685 TAGGAGAAACAGGAAGAGGAAGG + Intronic
1071430833 10:85605405-85605427 TTGGAGAAGCCTGAACAAGCTGG + Intronic
1071607281 10:87004953-87004975 TTAAAGAAGCAATAAGAGGCTGG + Intergenic
1071728865 10:88227892-88227914 TGAGACAAGCAAGCAGAGGCTGG - Intergenic
1072643869 10:97236271-97236293 TTAGAAAAGGCAGAAGAGGCTGG - Intronic
1073282337 10:102363686-102363708 TAGGAGTAGGAAGAAGAGGGGGG - Intronic
1073638465 10:105223482-105223504 TTAGAGAAGCAAGAACATGCAGG - Intronic
1073696969 10:105880412-105880434 TTGGAGAAGCACGAAAAAGGGGG - Intergenic
1073840261 10:107490761-107490783 TTGGAGAAGGGAGAAGTGACTGG + Intergenic
1073854188 10:107656041-107656063 TTGGAAGAACAAGAAGAGGTAGG - Intergenic
1074570858 10:114622749-114622771 GAGGAGAAGGAAGAAGAGGAGGG - Intronic
1075498282 10:122947440-122947462 ATGCAGAACTAAGAAGAGGCAGG + Intronic
1075873390 10:125787370-125787392 CTGGAGAAGCAAGACAAGCCCGG - Intronic
1076109674 10:127851108-127851130 GTGGAGAAGGAGGGAGAGGCAGG + Intergenic
1076293496 10:129366019-129366041 TGGGAGAAGCCAGAAGAGTGGGG + Intergenic
1076402466 10:130193051-130193073 TTGGAGAAGCAGGGACAGGGTGG - Intergenic
1076448260 10:130533867-130533889 TTGGGGGAGCAAGAGGAGGCTGG - Intergenic
1076714155 10:132354795-132354817 TGGGAGAAACAAGAGGAGGCCGG + Intronic
1077618775 11:3700057-3700079 TTAGAAAAGCAAGAAGGGGCCGG + Intronic
1077768525 11:5189348-5189370 CTGGAGCAGGAAGAAGAGGCAGG - Intergenic
1078592562 11:12657323-12657345 TTAGAAAAGTAAGAACAGGCCGG - Intergenic
1078759533 11:14241424-14241446 TGGGGGAAGCAAGAAGATACTGG + Intronic
1078760261 11:14245826-14245848 AAGGAGAAGCAACACGAGGCAGG + Intronic
1078923112 11:15849825-15849847 TTGGAGATCCAAGAAAAGGCTGG + Intergenic
1079083284 11:17428534-17428556 TGGGAGTAGCAAGGGGAGGCCGG + Intronic
1079123734 11:17703770-17703792 TTCTAGAAGCCAGAAAAGGCAGG - Intergenic
1079943096 11:26706397-26706419 GTGTGGGAGCAAGAAGAGGCTGG + Intronic
1081092377 11:38888350-38888372 ATGGAGAGGCAAGAAGTGGCGGG - Intergenic
1081291910 11:41336759-41336781 TAGGACAAGCAAGAAGGTGCTGG + Intronic
1081780121 11:45704654-45704676 TGGGAGAAGAAAGAGGAGGTGGG - Intergenic
1081938496 11:46920797-46920819 TTGGAGAAGAAACGAGAGGCGGG + Intergenic
1082958414 11:58896248-58896270 TAGGTGATGCATGAAGAGGCTGG - Intronic
1083065769 11:59922443-59922465 CTGGATAAGCAAGAAGTAGCTGG - Intergenic
1083504944 11:63147716-63147738 TTGGGGAAGCAAGGAAAGCCAGG + Intronic
1083748881 11:64750439-64750461 GTGGAGATGGCAGAAGAGGCGGG - Exonic
1083852902 11:65378299-65378321 GTGGAGTGGGAAGAAGAGGCAGG - Intronic
1085224848 11:74910586-74910608 ATGGAGAAGCAGGCAGAGTCAGG + Intronic
1085474112 11:76778760-76778782 TTGGAGCATCAAGTTGAGGCAGG + Intergenic
1085892152 11:80593263-80593285 TTGGAGAAGCAAAAAGGGACAGG + Intergenic
1087017763 11:93571317-93571339 ATGGAAAAGCAAGCAGAGACAGG + Intergenic
1087304157 11:96469488-96469510 GTGGAGTAGAAAGAAGAGGAGGG + Intronic
1088303750 11:108386615-108386637 ATGGAAAAGCACCAAGAGGCAGG + Intronic
1088502611 11:110497730-110497752 TTGGAGCAACAGGAAGAGACAGG + Intergenic
1089390531 11:118098784-118098806 CTGGATAAGTAAGAAGAGGCAGG + Intronic
1089454449 11:118617892-118617914 ATAGAGCAGCAAGGAGAGGCAGG + Intronic
1089689373 11:120177680-120177702 GTGGAGAAGCCAGAAGGGTCAGG - Intronic
1089925009 11:122248197-122248219 ATAGAGAAGAAATAAGAGGCAGG + Intergenic
1090775888 11:129965489-129965511 TAGGAGACGCAAGAAGATGAGGG - Intronic
1091027827 11:132157942-132157964 TGGGAGAGGGCAGAAGAGGCAGG - Intronic
1091218804 11:133918926-133918948 CTGGAGAAGGAAGGAGGGGCAGG + Intronic
1091307226 11:134544010-134544032 GTGGAGAAGGAAGCAGAGGTGGG - Intergenic
1091376417 12:27327-27349 TTGCAGAGGAAAAAAGAGGCTGG + Intergenic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091601060 12:1918057-1918079 TGGGAGGAGAAAGAGGAGGCCGG + Intronic
1091744499 12:2982513-2982535 TTGGGGAAGGAGGAGGAGGCTGG + Intronic
1091988348 12:4932752-4932774 TGCCAGAAGCTAGAAGAGGCAGG - Intergenic
1092010195 12:5103647-5103669 TTGGAGAAGGAACAAGAGATTGG - Intergenic
1093484915 12:19641980-19642002 TTGGAGGAACAAGAGGAAGCTGG - Intronic
1093785967 12:23192660-23192682 TAGGGGAAGGAGGAAGAGGCAGG - Intergenic
1093785986 12:23192736-23192758 TGGGGGAAGGAAGAAGAGGCAGG - Intergenic
1095344805 12:41137737-41137759 TAGGTGAAGAAAGAATAGGCTGG - Intergenic
1095663636 12:44767852-44767874 TTGGAGGAGAAAGAATAGGGAGG + Intronic
1096452288 12:51754056-51754078 TTGGGGAGGGTAGAAGAGGCAGG - Intronic
1098377415 12:69831958-69831980 TTGAAGAATAAAGAGGAGGCTGG + Intronic
1098548679 12:71739354-71739376 TTAGAAATGGAAGAAGAGGCCGG + Intergenic
1099567022 12:84264520-84264542 TTAGAATAGAAAGAAGAGGCTGG + Intergenic
1100446563 12:94666001-94666023 ATGGAGAAGCAGGGAAAGGCTGG - Intergenic
1100474416 12:94922448-94922470 TTGGAGATGGAAGAACAAGCAGG + Intronic
1101566102 12:105907104-105907126 TTGGAGAAGAAATAAGAAGGAGG - Intergenic
1102119627 12:110429993-110430015 CTGGAGAAGTAGGAAGAGGAGGG - Intergenic
1102167991 12:110821209-110821231 TTTGAGAAGAAAGAAGAGGCTGG - Intergenic
1102230095 12:111256417-111256439 GTGGACAAGCGAGAGGAGGCAGG - Intronic
1102443621 12:112983518-112983540 TTAGAAAAGCAAGAAAAGCCAGG - Intronic
1103117349 12:118347637-118347659 TAGGATAAGCCAGAAGAGGTGGG - Intronic
1103451471 12:121032296-121032318 TTGGAGAAGGTATAAGAGACAGG - Intronic
1104567215 12:129895835-129895857 TTGGTGAAGGAAGAAGAGAAAGG + Intronic
1105607758 13:21941395-21941417 TTGGAGAAGAAAAAAGAAGTAGG - Intergenic
1108176593 13:47798740-47798762 CTGGAGAGGCAAAAGGAGGCAGG + Intergenic
1108892969 13:55284796-55284818 AAGGAGAAGAAAGAAGAAGCAGG + Intergenic
1109995673 13:70121832-70121854 TGGGAAAAGCAAGAAGAAGGAGG + Intergenic
1111194209 13:84851239-84851261 CTGGAAAAGCAAAGAGAGGCAGG - Intergenic
1112222725 13:97507447-97507469 TTGGAGAAGCAAGAGTAGCAAGG - Intergenic
1112335095 13:98508105-98508127 TTGAAGTAGCAAGAAGCGGTGGG - Intronic
1112607082 13:100917077-100917099 TAGGAGCAGCACGAAGAGGGTGG + Intergenic
1113090426 13:106612302-106612324 CTTGAGAAGCCAGAAGAGGTGGG - Intergenic
1116162010 14:41279524-41279546 TTGAAGTAACAAGTAGAGGCAGG - Intergenic
1116774943 14:49168148-49168170 TCGGAGAAGTAAGAAGGAGCTGG + Intergenic
1117346916 14:54841648-54841670 TTGGGGAAGGAAGAGTAGGCTGG - Intergenic
1117463620 14:55971235-55971257 CTGGAGAAGGAAGCAGAGGTTGG - Intergenic
1117613433 14:57507552-57507574 TTGCAGAAGCAGGAAGATGATGG - Intergenic
1117636895 14:57753734-57753756 GTGGAGAATCAGGAAGAGGTTGG - Intronic
1117802066 14:59454803-59454825 TTAGAAAATCAAGGAGAGGCCGG + Intronic
1117963814 14:61187589-61187611 TTGGAGCAGCAGCAGGAGGCAGG - Intronic
1117978701 14:61321695-61321717 GAGGAGAAGCAAGAGGAGGCGGG + Exonic
1118329534 14:64804710-64804732 TGGGAGAAGCATGAAGGGGTGGG + Intronic
1118588205 14:67377133-67377155 TTGGATAAGAGAGAAAAGGCAGG - Intronic
1118604843 14:67495268-67495290 ATGGAGAAGCAAGAAAAAGGAGG - Intronic
1118767721 14:68921322-68921344 AAGCAGAAGAAAGAAGAGGCAGG - Intronic
1119353187 14:73983238-73983260 TTGTGGGAGCAAGAAGAGGGAGG + Intronic
1119589392 14:75871089-75871111 TTGAAAAAGCAAGCATAGGCCGG - Intronic
1119707515 14:76793444-76793466 GAGGAGAAGGAAGAAGAGGGAGG + Intronic
1119745083 14:77038303-77038325 TAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1120241453 14:81954247-81954269 GTAGAGAAGCAAGAAGAGTTTGG - Intergenic
1120440738 14:84535689-84535711 TTGGTGAAGCAACAAGAGACTGG - Intergenic
1120724613 14:87923810-87923832 TTGGAGAAGGAAGGAGATGGAGG + Intronic
1121065997 14:90965551-90965573 TTTGAGAAGTAATAAGAGGCTGG + Intronic
1121224728 14:92312897-92312919 TTGGAGAAGCAACAAGAAATTGG + Intergenic
1121355192 14:93207723-93207745 GTGGTGCACCAAGAAGAGGCTGG - Intronic
1122126308 14:99580403-99580425 CTGGAAAAGCAAGCAGAGGGCGG + Intronic
1122415735 14:101548693-101548715 CTGGAGAGGGAAGAGGAGGCGGG + Intergenic
1122601319 14:102923246-102923268 TATGAGAAGTAAGAAGGGGCTGG - Intronic
1124433912 15:29632226-29632248 TTGGAAAAGTAAAAAGAGGCAGG - Intergenic
1125089623 15:35774908-35774930 TTGGAGAAGCGAGCTCAGGCTGG + Intergenic
1125168874 15:36743129-36743151 TTGGAGAAGTAAGACGAGCCAGG + Intronic
1125338536 15:38652060-38652082 TTGGAGAGGCAGGAAGAGAGGGG - Intergenic
1125599091 15:40906050-40906072 TAGGAGAAGACAGAAGGGGCAGG - Intergenic
1126933165 15:53677214-53677236 TTTAAGAAGCAAGAATTGGCTGG - Intronic
1127969584 15:63947846-63947868 TGGGAGAAGGAAGAAGAGCTGGG - Intronic
1128305053 15:66592955-66592977 TTGGAGTAGCAGGAAGAGAAAGG - Intronic
1128536399 15:68493901-68493923 TAGGACAAACAAGCAGAGGCTGG - Intergenic
1128668157 15:69553728-69553750 GAAGAGAAGGAAGAAGAGGCAGG - Intergenic
1128727792 15:70000594-70000616 GAGAAGAAGCAAGAAGAGCCAGG + Intergenic
1128775734 15:70318693-70318715 TTTGGGAAGCAACAAGAGGGAGG + Intergenic
1128786517 15:70401462-70401484 GTGGGGAAGCAAGAGAAGGCTGG - Intergenic
1128898190 15:71394988-71395010 TTGGAGAACCAAGGATAGTCTGG + Intronic
1129228102 15:74181465-74181487 TGGGAGAAGAAAGCTGAGGCAGG + Intronic
1129294066 15:74590020-74590042 TGGGAGAAGGAAGCTGAGGCTGG + Intronic
1129549752 15:76435462-76435484 TTGGAGAAGGAAAAAGAATCAGG - Intronic
1129752687 15:78077152-78077174 GTGGAGAAGCAGGGAAAGGCAGG + Intronic
1129816080 15:78555653-78555675 TTAGAAAAGCAATTAGAGGCCGG - Intergenic
1129819442 15:78587568-78587590 TCAGATAAGCAAGAAGAGGCTGG + Intronic
1130626886 15:85524468-85524490 TAATAAAAGCAAGAAGAGGCTGG - Intronic
1130839487 15:87684442-87684464 TTGGATAGGCAAGAAAGGGCAGG - Intergenic
1131140938 15:89976699-89976721 TATAAGAAGCAAGATGAGGCTGG + Intergenic
1131573288 15:93561020-93561042 ATGGAAAAGGAAAAAGAGGCTGG + Intergenic
1131625957 15:94120934-94120956 GAGGAGAAGGAAGAAGAGGAGGG - Intergenic
1132220292 15:100100253-100100275 TCGAAGAAGCAAGAGGAGGGAGG - Intronic
1132450507 15:101965675-101965697 TTGCAGAGGAAAAAAGAGGCTGG - Intergenic
1132828255 16:1915571-1915593 TTAGAAAAGCAAGAGGAGGGTGG - Intronic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133583220 16:7166501-7166523 TTGGAGAAGAAGGAACAGGATGG + Intronic
1134081354 16:11327214-11327236 ATGGAGAGGCAAGAGGAGGGAGG + Intronic
1135240881 16:20806432-20806454 TTGGAAAAGCAAGGAGTGTCGGG - Exonic
1135387199 16:22053259-22053281 TTTAAGAAGGAAGAATAGGCTGG - Intronic
1135572697 16:23561406-23561428 ATGGAGAAGAAAGAAGACTCAGG + Intronic
1135646738 16:24169481-24169503 TTGGAGAAGAAAGAAGAAGGGGG - Intronic
1135678908 16:24440368-24440390 ATGCAGTAGCAAGAAGGGGCAGG + Intergenic
1135857735 16:26027523-26027545 TTGGAGAAGCAAAATGAGATAGG - Intronic
1137029139 16:35506239-35506261 AGGGAGGAGCAAGAAGGGGCGGG + Intergenic
1137543679 16:49382810-49382832 GTGGAGAAGGAAGACGAGGGAGG - Intronic
1137823552 16:51468288-51468310 TAGGAGAAGCAAGAAGAGTTTGG - Intergenic
1138062500 16:53906723-53906745 TGGTAGAAGCAGGAAGATGCAGG + Intronic
1138405274 16:56788028-56788050 TTGGAGACGCAAGAAAAGAGAGG - Intronic
1139021054 16:62749897-62749919 AAGGAGGAGGAAGAAGAGGCAGG + Intergenic
1139064193 16:63291937-63291959 TGGGAGAAGCCAGAAGAAGATGG - Intergenic
1139768637 16:69254322-69254344 TTGGAGAATCCCTAAGAGGCCGG - Intronic
1141065856 16:80913068-80913090 TTGGAGAAGCAGGAAGAGCCAGG - Intergenic
1141283241 16:82647755-82647777 ATGGAAAAGCCAGAAGAGACAGG + Intronic
1141527137 16:84618546-84618568 TGGGATAGGCAAGAAGAGGGAGG - Intergenic
1142329201 16:89440130-89440152 CTGGAGAAGTAGGAAGAGGCAGG - Intronic
1142611289 17:1110153-1110175 TTGGAGAAGCCAGGGGAAGCTGG - Intronic
1143131719 17:4682685-4682707 TTGAAGAAGTGAGAAGAGGGAGG - Intronic
1143236063 17:5402018-5402040 TAGAAGAACCAAGAAAAGGCTGG + Intronic
1143475914 17:7203892-7203914 TTGGAGCAGCCAGAGGAGGAAGG + Intronic
1143537771 17:7551371-7551393 GTGGGGAAGCAGCAAGAGGCTGG - Intronic
1144146633 17:12405227-12405249 TTTAAGAAGCAAGTTGAGGCTGG - Intergenic
1145034287 17:19529569-19529591 TTGGAGATGGAGGAAGAGGGAGG + Intronic
1145254011 17:21313004-21313026 TTGGGTAAGGAAGAAGCGGCCGG + Intronic
1145322585 17:21774958-21774980 TTGGGTAAGGAAGAAGCGGCCGG - Intergenic
1146466304 17:33089370-33089392 TTCTAGAAGCAGGAAAAGGCAGG + Intronic
1147499973 17:40953619-40953641 TTGGAGAAGGAAAAAGAGAAAGG + Intergenic
1148245602 17:46027942-46027964 TTGGAGAACAAAGATGAGGAGGG - Exonic
1148446235 17:47739287-47739309 ATGGAGACACAGGAAGAGGCTGG - Intronic
1149310254 17:55386328-55386350 CTGGAGAGGGAGGAAGAGGCGGG - Intergenic
1150127533 17:62648105-62648127 TTAGAGAGGGAAGAACAGGCCGG + Intronic
1150208273 17:63426055-63426077 TGGGAGCATCAAGAGGAGGCTGG - Exonic
1150454385 17:65294999-65295021 TTAAAGAAGCAAGAGGAGGCTGG + Intergenic
1151496493 17:74461188-74461210 TTGGAGCAGAGAGAAGATGCTGG + Intergenic
1151751662 17:76042178-76042200 TTAGAAAAGCAAGCAGGGGCCGG - Intronic
1152031248 17:77844902-77844924 TTGGAGAAGCATGGGGAGGCAGG - Intergenic
1152761290 17:82108332-82108354 TTCGAGGAGCAAGAACAGCCCGG - Intronic
1152946148 17:83198662-83198684 TAGAAGAGGCAAGAAGAAGCGGG - Intergenic
1152969386 18:147160-147182 TTATAGAATTAAGAAGAGGCCGG - Intergenic
1155242515 18:23877116-23877138 TTGGAGAAGACAGATGAGGGAGG + Intronic
1155620177 18:27769132-27769154 TTGGAAAAAATAGAAGAGGCAGG + Intergenic
1156266945 18:35497802-35497824 CCGGAACAGCAAGAAGAGGCCGG - Exonic
1156685059 18:39634422-39634444 TTAGAGAAGAATGAAGAGGTAGG - Intergenic
1157020273 18:43773141-43773163 TTGGAACAGAAAGAAGAAGCTGG + Intergenic
1157583649 18:48787639-48787661 CCTGAGAAGGAAGAAGAGGCAGG + Intronic
1158332116 18:56374512-56374534 TGAGAGAAAGAAGAAGAGGCAGG - Intergenic
1158710286 18:59831336-59831358 TTAAAGAAAAAAGAAGAGGCTGG + Intergenic
1158803123 18:60936803-60936825 CTGGAGCAGGAGGAAGAGGCAGG + Intergenic
1160420722 18:78742161-78742183 GTGGAGATGGAAGCAGAGGCTGG - Intergenic
1160634750 19:66872-66894 TTGCAGAGGAAAAAAGAGGCTGG + Intergenic
1161161943 19:2766730-2766752 GTCAAAAAGCAAGAAGAGGCCGG - Intronic
1162036312 19:7941651-7941673 TCTGAGAAGCAAGCAGAAGCTGG + Intronic
1162378531 19:10318722-10318744 CTGGAGGAGGAAGAGGAGGCGGG - Intronic
1162461328 19:10815913-10815935 AGGGAGAAGCAAAGAGAGGCGGG + Intronic
1164292625 19:23881449-23881471 TAGGAGGAGGAAGAAGAGGAGGG + Intergenic
1166088398 19:40492143-40492165 ATGGGGAAGCAACAAGGGGCAGG + Intronic
1166532552 19:43551810-43551832 TGGGAGAAACAAAAAGAGGTTGG + Intronic
1166916077 19:46196833-46196855 TGGGAGAAGGAAGAAGAGGAGGG - Intergenic
1168283962 19:55321320-55321342 TGGGAGGTGCAAGGAGAGGCTGG - Intronic
925610326 2:5696618-5696640 GTGGCGAGGCAAGAAGAGCCAGG - Exonic
925733962 2:6944175-6944197 TTGGAGATGCGGGAGGAGGCCGG + Intronic
926024161 2:9525416-9525438 TTCATGAAGCAAGAAGAAGCTGG - Intronic
926410565 2:12597897-12597919 TTCCAGAAGAAAGAAGAGGCAGG - Intergenic
926789592 2:16556776-16556798 ATGGAGGAGCAAGTAGAGACAGG + Intronic
927220332 2:20701860-20701882 ATGGAGAAGCCAGATGAGGTTGG - Intronic
927280886 2:21305448-21305470 TTGGAGAAGAAAGTGAAGGCAGG + Intergenic
927500503 2:23579769-23579791 TTGGTGAAGCCAGAAGAGGTGGG - Intronic
928158601 2:28899940-28899962 TGGTAGAAGCAAGCAGGGGCAGG - Intronic
929310545 2:40419229-40419251 TTTGAGAAGCCAGAAGTAGCCGG - Intronic
929589774 2:43137390-43137412 TAGTGGGAGCAAGAAGAGGCAGG - Intergenic
930436897 2:51355752-51355774 TTGCAGAAGCAACAAAATGCAGG - Intergenic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
930749930 2:54924857-54924879 TTGAAAAAAAAAGAAGAGGCTGG - Intronic
931208821 2:60173120-60173142 CTGAAGAAGAAAGAAGAGGGAGG + Intergenic
931758208 2:65393245-65393267 TTGGGGAAGGGAGTAGAGGCTGG - Intronic
931789814 2:65654745-65654767 TTGGAGAATCAGGCACAGGCTGG - Intergenic
932335461 2:70928564-70928586 TGGGTGTAGCAAGGAGAGGCGGG - Intronic
934535346 2:95128732-95128754 TAGGAGAAGGAAGAAGAAGGAGG + Intronic
934664294 2:96158958-96158980 TTGAAGGGGCAAGAAGGGGCTGG - Intergenic
936045153 2:109181711-109181733 CTGGAGAAGAAAGAGGAGGCAGG - Intronic
936259502 2:110946920-110946942 TTGGTGAGTCAAGGAGAGGCTGG + Intronic
936566729 2:113588155-113588177 TTGCAGAGGAAAGAAGAGGCTGG - Intergenic
936594652 2:113836245-113836267 TTAGAAAAGAAAGAAGAGGCCGG - Intergenic
936635909 2:114257731-114257753 TTTGATAAGCAAGAAGTGACTGG - Intergenic
937048064 2:118863333-118863355 GGAGAGAAGCAAGGAGAGGCTGG + Intergenic
937165356 2:119809528-119809550 TTGGAGTAGCCAAAAGGGGCGGG - Intronic
937355596 2:121196315-121196337 TTGGAGCAGCCAAGAGAGGCAGG + Intergenic
940127273 2:150340649-150340671 TTGGGGAAGTAAAAAGAGACAGG - Intergenic
941172778 2:162159990-162160012 ATGAAGAGGCAAGATGAGGCTGG + Intergenic
941277458 2:163508114-163508136 TTCTAAAAGCAAGAATAGGCTGG + Intergenic
941953814 2:171184171-171184193 TTCTAGAAGCTAGAAAAGGCAGG + Intronic
942449416 2:176099862-176099884 TTGGAGAAGTAGAAAGAGTCTGG - Exonic
943278271 2:185896885-185896907 GAGGAGAAGGAAGAAGAGGAGGG + Intergenic
943390361 2:187259604-187259626 ATGGAGAAGCCAGAAAAAGCTGG + Intergenic
943567968 2:189539257-189539279 ATAGAGAATCAAGAAGAGGGAGG + Intergenic
943963949 2:194306684-194306706 TTGGTGAAGAACTAAGAGGCAGG + Intergenic
944841063 2:203624172-203624194 GTGAAGATGCAAGAAGAGGTTGG - Intergenic
944900999 2:204216039-204216061 TTGGAGGAGAAGGAAGAGGAAGG - Intergenic
945043956 2:205765622-205765644 TGGGATAAGCAAGAGGAGGCAGG + Intronic
945714690 2:213343905-213343927 TTTGAAATCCAAGAAGAGGCTGG + Intronic
945851447 2:215013294-215013316 TTGGAAGAACAAGAAGAGGAAGG + Intronic
945860076 2:215110857-215110879 TTTGTGAAGCAAGAAGTGTCTGG + Intronic
946762525 2:223008882-223008904 TGGAAGAAGAGAGAAGAGGCTGG - Intergenic
947774651 2:232697768-232697790 GCGGAGAAGCAAGCAGAGGAAGG - Intronic
948150412 2:235740112-235740134 TTGGAGAAGGCAGAGGAGCCAGG + Intronic
948248101 2:236503503-236503525 TTGGGGAAGAAAGAAATGGCAGG - Intronic
948260540 2:236601220-236601242 TGGGAGAACCAGGCAGAGGCTGG - Intergenic
948295135 2:236855157-236855179 TGGGAGAAGGAGGATGAGGCAGG - Intergenic
948759526 2:240182172-240182194 TAGGAGATGCTAGGAGAGGCTGG - Intergenic
1169135741 20:3195993-3196015 GTGGAGGAGAGAGAAGAGGCAGG - Intronic
1169316305 20:4593363-4593385 ACAGAGAAGCAAGAAGATGCTGG - Intergenic
1169516551 20:6322237-6322259 TTAAAGAAGCAACAACAGGCTGG - Intergenic
1169848676 20:10025697-10025719 TGGGAGAAGCTAGAAGATACTGG + Intronic
1170936122 20:20811250-20811272 ATGGAGAAGCAGCAAGAGTCTGG + Intergenic
1172654329 20:36527817-36527839 TTGCTGAAGGAAGAAGGGGCTGG - Exonic
1173117320 20:40257748-40257770 TTGGAGATGCAAGGATAGACTGG - Intergenic
1173226239 20:41163898-41163920 CTGGATAGGCAAGGAGAGGCAGG - Intronic
1174842052 20:53910232-53910254 TTTTAAAAGCAAAAAGAGGCCGG - Intergenic
1175034996 20:55991741-55991763 ATGAAAAAGCAAGAAGCGGCTGG - Intergenic
1175155294 20:56967287-56967309 ACGGAGAAGAAAGAGGAGGCTGG - Intergenic
1175771084 20:61624771-61624793 TTGCAGAAGGAAGAAGAGTCGGG + Intronic
1175936648 20:62517307-62517329 TGGGAGAAGGAAGAAGAAGGAGG + Intergenic
1175981192 20:62739474-62739496 CTGGGGAAGCAAGGAGAGCCAGG + Intronic
1176986502 21:15443535-15443557 TTGGAGAAGAAAGAAAAGGGTGG + Intergenic
1177953271 21:27565851-27565873 CTGGAGAACCAAGCTGAGGCTGG - Intergenic
1178681798 21:34678556-34678578 TTGTAGAAGAAAGAACTGGCAGG + Intronic
1178887676 21:36496656-36496678 ATGGAGAAGAAAGCAGAGGAAGG + Intronic
1179015933 21:37594599-37594621 TCGGAGAAGGAAGCAGAGGAGGG + Intergenic
1179257589 21:39730133-39730155 TAGCAGAAGCAGGAAGAAGCAGG - Intergenic
1179662705 21:42887439-42887461 TTGCAGTAACAAGTAGAGGCTGG - Intronic
1180007344 21:45028823-45028845 CTCCAGAAGCCAGAAGAGGCAGG - Intergenic
1180847889 22:18994347-18994369 GTAGAGAAGGGAGAAGAGGCAGG - Intergenic
1181346881 22:22225792-22225814 TTTGAGAAGAGAGAAAAGGCTGG - Intergenic
1181581706 22:23832405-23832427 TGGGAGAAGCAAGGGCAGGCCGG - Intronic
1181887891 22:26036089-26036111 TTGTTGCAGCTAGAAGAGGCAGG + Intergenic
1181888110 22:26037704-26037726 TGGGAGAAGGGAGAACAGGCTGG - Intergenic
1182456589 22:30455658-30455680 TTGGGGAAGGAGTAAGAGGCAGG + Intronic
1182496515 22:30712195-30712217 TTGGAGAAGAAAGAGGAGGAGGG - Intronic
1182577118 22:31280493-31280515 ATGCAGAAGCAAGAAGAAACTGG - Intergenic
1182961902 22:34483292-34483314 CTGGAGAGGTAAGCAGAGGCTGG + Intergenic
1183191814 22:36326441-36326463 TTGGGGAATGAAGCAGAGGCTGG - Intronic
1183297156 22:37037102-37037124 TTGGAAAAGCAAGCACAGCCTGG - Intergenic
1183593977 22:38798563-38798585 ATGGAGCAGCAAGAAGAAGATGG - Intergenic
1183781672 22:40002940-40002962 TTGCAGAACTCAGAAGAGGCTGG + Intronic
1184085010 22:42256097-42256119 TTGGAGAAGCCGGTAGAGGAGGG - Intronic
1184259095 22:43304480-43304502 TGTGAGAAGCAGGAACAGGCAGG + Intronic
1184682769 22:46080734-46080756 TTGGAGAACCAATTAGAGGGAGG - Intronic
1184797978 22:46742740-46742762 TTGAAGACACCAGAAGAGGCAGG - Intergenic
1184884727 22:47335797-47335819 GTGGGAAAGCAAGAACAGGCTGG - Intergenic
1185126358 22:49012984-49013006 TTGGGGAAGGAAGAAAAGTCTGG - Intergenic
1185263637 22:49885745-49885767 CTGGAGAAGTAGGAAGGGGCGGG - Exonic
950114979 3:10444873-10444895 AGGAAGAAGAAAGAAGAGGCAGG - Intronic
950404612 3:12796890-12796912 AGGGAGAAGAGAGAAGAGGCAGG - Intronic
950967712 3:17157508-17157530 GTGGAGCAGAGAGAAGAGGCCGG - Intronic
952758492 3:36892989-36893011 TGGGAGAAGACAGAAAAGGCTGG + Intronic
952781427 3:37103535-37103557 TTGGGGAACTAAAAAGAGGCCGG - Intronic
952802179 3:37304798-37304820 TTGGAGAAGCAAGCAAGGGAAGG - Intronic
953339172 3:42119422-42119444 TTGGAGAAAATAGCAGAGGCTGG + Intronic
953376215 3:42430669-42430691 TAGGAGAGGGATGAAGAGGCTGG - Intergenic
953653532 3:44828369-44828391 CTGGAGGTGCAAGAAGAGGTAGG - Intronic
954498429 3:50987688-50987710 ATGGAGAACGAAGAAAAGGCAGG + Intronic
954518124 3:51198201-51198223 TTGGAGAAGCAAATAGACCCAGG + Intronic
954684681 3:52364044-52364066 TTGGAGCTGCATGAAGAGGCTGG - Intronic
955520515 3:59771213-59771235 TTGCAGAAGGAAGAACAGGTGGG + Intronic
955554001 3:60116444-60116466 ATGGAGAAGCAAGAAAAGAGGGG - Intronic
956319333 3:67978940-67978962 ATGGAGAAACAAGAAGAGAATGG - Intergenic
956737619 3:72250195-72250217 GGGGAGAAGCAGGAGGAGGCTGG + Intergenic
956872090 3:73428127-73428149 TGGGAGAGGTCAGAAGAGGCTGG + Intronic
957235814 3:77588893-77588915 TTGGCGAAGAAAGAAGAGGAAGG + Exonic
957578514 3:82040017-82040039 TTGTAGAAACAGGAACAGGCTGG - Intergenic
959710396 3:109380142-109380164 TTGGAGTCCCAAGAAGATGCTGG - Intergenic
960274255 3:115709227-115709249 CTGCAAAAGCAAGAGGAGGCAGG - Intronic
960972665 3:123150700-123150722 CTGGAGAAGGAAGAGGGGGCGGG - Intronic
961054202 3:123774062-123774084 ATGGAAAAGCAAGGAGAGGCTGG + Intronic
961070278 3:123917705-123917727 TTAGAGAAGCCTGGAGAGGCAGG + Intronic
961172695 3:124809442-124809464 CTGGAGAAGCAAGCAGGGGATGG - Intronic
961928867 3:130512375-130512397 GTAGAGAAGTAAGCAGAGGCAGG - Intergenic
962143575 3:132816890-132816912 TTGGGGAACCAGGAACAGGCTGG + Intergenic
962184271 3:133241908-133241930 TTGTAGAAGCCACAGGAGGCCGG - Intronic
962545465 3:136429715-136429737 ATGGAGAAGGAAGGAGAGGCAGG - Intronic
963108324 3:141665190-141665212 TTAAAGAAGAAAAAAGAGGCTGG + Intergenic
964426142 3:156555528-156555550 TTGAAGAAGAAAGAAGAGAAAGG + Intergenic
964540416 3:157773520-157773542 TTGGAGAAGAAAGGGTAGGCTGG - Intergenic
964627712 3:158775553-158775575 CTGGAGAGGGAAGAAGAGCCTGG + Intronic
964749830 3:160043978-160044000 TTAGAGTAGCAAGAATGGGCTGG - Intergenic
965186283 3:165468495-165468517 TTGGACAAGCAGGAAGAGGAAGG - Intergenic
965442922 3:168738552-168738574 TTAGAGAAGCAGGACAAGGCAGG + Intergenic
966225009 3:177588934-177588956 TTGACAAAGCAAGAAGAGACAGG - Intergenic
966225297 3:177591317-177591339 TTGGAGGAGCAAAGAGAGGAGGG - Intergenic
966233605 3:177675370-177675392 TTTAAGAAGCAAGCAGATGCTGG - Intergenic
966241636 3:177760796-177760818 TTGGAGAAGGAAAAAGTGGTTGG + Intergenic
966430055 3:179821894-179821916 TAGGAAAAGTATGAAGAGGCAGG - Intronic
967192610 3:186997948-186997970 TTAAAAAAGCAAAAAGAGGCCGG + Intronic
967947867 3:194818460-194818482 TGGGAGAAGGACGACGAGGCTGG - Intergenic
968135261 3:196216121-196216143 CTGGAAAAGCCAGATGAGGCCGG - Intronic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
968672158 4:1857431-1857453 GCGGAGAAGCAGGAGGAGGCAGG - Intergenic
968861202 4:3171771-3171793 TTCAAGAATCAAGAAGGGGCTGG - Intronic
968994149 4:3935213-3935235 TTGGAGAAGCCGGGAGAGGAGGG + Intergenic
969066229 4:4483812-4483834 TTGGAGAAGAGAGAAGACTCAGG - Intronic
969309566 4:6345622-6345644 CTCTAGAAGCCAGAAGAGGCAGG + Intronic
969855927 4:9999628-9999650 TTGGAGGGGCAAGAAAGGGCAGG + Intronic
970145892 4:13035394-13035416 TTCTTGAAGCAAAAAGAGGCAGG + Intergenic
970564733 4:17320686-17320708 TTGGAGAACCAAAAAGAAGAAGG - Intergenic
971495206 4:27256910-27256932 TTGGAGAAGATAGAAGAGTTAGG - Intergenic
974380494 4:61133928-61133950 ATGGAGAAGCAATTAAAGGCTGG + Intergenic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
975706679 4:77118920-77118942 TTTTAGAAACAAGAAAAGGCAGG - Intergenic
976306155 4:83561444-83561466 TTGCAGAGGCAAGAAGAAGAAGG - Intronic
976420778 4:84841196-84841218 GTGAAGAAGCCAGTAGAGGCTGG - Exonic
977350966 4:95886338-95886360 AGGGAGGAGCAAGAAGAAGCAGG + Intergenic
977512831 4:97983133-97983155 TAGGAGGAGGAAGAAGAGGAAGG - Intronic
978430557 4:108628564-108628586 TTGGAGCAGCAAGGAGAGGGAGG - Intronic
979267560 4:118720947-118720969 TTGGAGAAGCAAGTAGAGTGAGG - Intergenic
980720239 4:136686301-136686323 TATGAGCAGCATGAAGAGGCGGG - Intergenic
980988501 4:139718376-139718398 AAGGAGAAGCAAGGGGAGGCTGG + Exonic
982176883 4:152714282-152714304 TTGGAGAAGCCTGGAGAGACAGG - Intronic
983467760 4:168116020-168116042 TTTGAAAAGCAAGAAAAGGAAGG + Intronic
983734356 4:171039172-171039194 TTGGAAAAGCAAGAGGAGTTGGG - Intergenic
984213632 4:176880689-176880711 TTGGGAAAGCAAGAAGATGTGGG + Intergenic
985325832 4:188769039-188769061 TTGGAGTAGCAAAATAAGGCTGG + Intergenic
985671573 5:1209494-1209516 TTGGAGACTCAGGGAGAGGCTGG - Intronic
985677749 5:1241016-1241038 GTGCAGAAGCTGGAAGAGGCGGG + Intronic
985877750 5:2613183-2613205 TCTGAGACGCAAGAGGAGGCAGG - Intergenic
985926929 5:3026275-3026297 GAGGAGAAGCAGGGAGAGGCAGG - Intergenic
986285345 5:6354669-6354691 TGGGAGAAGGAGGCAGAGGCTGG + Intergenic
986372820 5:7097834-7097856 TTGGAGGAGAGAGAAGAGGGGGG + Intergenic
986724815 5:10586367-10586389 ATGAAGAAGAAAGAAAAGGCTGG + Intronic
987064995 5:14281305-14281327 TTGGAGCAGGAGGAAGAGGGTGG + Intronic
987116725 5:14731658-14731680 TTAGAGAATCAGGGAGAGGCTGG + Intronic
987778595 5:22401859-22401881 GTGGAGAAGGAAGAAGAGATTGG + Intronic
988335718 5:29906325-29906347 TTAGAGTAATAAGAAGAGGCAGG - Intergenic
988721170 5:33880839-33880861 TTGGAGGGGGAAGAAGAGGGAGG - Intronic
989194044 5:38698790-38698812 TTGGAGAACCATGTAGATGCTGG - Intergenic
989220521 5:38956412-38956434 GTGGAGTGGCAAGATGAGGCTGG - Intronic
989384151 5:40837834-40837856 TTGTAGAAATAAAAAGAGGCAGG - Intergenic
990000116 5:50882877-50882899 ATGGAGTGGCAAGAAGAGGAAGG - Intergenic
990868522 5:60405919-60405941 TTGGGGCAGGAAGAAGGGGCAGG - Intronic
991610087 5:68440834-68440856 TTGAAGAGGCCAGAAGAGGATGG - Intergenic
992466699 5:77013162-77013184 TTGGAGACGCACAAAAAGGCAGG - Intergenic
992485271 5:77188907-77188929 TGGGGGAAGGGAGAAGAGGCTGG + Intergenic
992969951 5:82046169-82046191 TTGGAGAAGCAGGAAGAGGTAGG - Intronic
993908338 5:93649321-93649343 TTGGAGAAGCAACCAAAAGCAGG + Intronic
994252994 5:97558875-97558897 TTGGAGAAGGAAGAGAAGGCTGG + Intergenic
994286326 5:97972589-97972611 TTTTAGAAGCTAGAAAAGGCAGG + Intergenic
994750931 5:103736087-103736109 TTCTAGAAGCTAGAAAAGGCAGG - Intergenic
995387422 5:111603216-111603238 TTGCAGAAGCCTGAAGAGTCAGG + Intergenic
995478886 5:112575847-112575869 GTGGAGAAGTAAGAAGATGCAGG + Intergenic
996988232 5:129594786-129594808 TTGGGGAAGGGAGAAGAGGAGGG - Intronic
997084271 5:130778519-130778541 GAGGAGAAGGAAGAAGAGGAGGG + Intergenic
997467713 5:134099370-134099392 TTGGGGATGCTAGAGGAGGCTGG + Intergenic
997559672 5:134835351-134835373 ATTGAAAAGCAGGAAGAGGCCGG + Intronic
997722289 5:136088791-136088813 CTGGATAAGGAAGCAGAGGCTGG + Intergenic
998042597 5:138961898-138961920 TTGGAGAAGCTAAAAGGGGAAGG - Intronic
998163758 5:139828658-139828680 TTTCAGAAGCAGGATGAGGCAGG - Intronic
998233108 5:140374235-140374257 TTGGAGAAGCATGAAGATGAGGG - Intronic
998438176 5:142131808-142131830 TTGCAGAATGAAGAAGAGTCTGG + Exonic
998591191 5:143480140-143480162 TTAGATAAGAAAGAAGATGCTGG - Intergenic
999053476 5:148549082-148549104 CTGGAGAAGTCAGGAGAGGCTGG - Intronic
999783555 5:154870716-154870738 TTTCAGAAGCATGAAGAGGAAGG + Exonic
1000822469 5:166001627-166001649 TTGTAAAAGCAAAAATAGGCTGG + Intergenic
1001090592 5:168737313-168737335 TTGAAGAAGCAAGAAGGACCTGG - Intronic
1001833515 5:174809800-174809822 TTGGAGAATCAAGAGGTAGCTGG - Intergenic
1002817104 6:691416-691438 GTGGAGGAGGAAGAAGAGGAGGG - Intronic
1002995369 6:2278118-2278140 TTGGAGAAACATGAAGACGTTGG - Intergenic
1004272814 6:14210815-14210837 ATGGATAAGCAACAAGTGGCTGG + Intergenic
1004528447 6:16430912-16430934 TTACAGAAGAAAAAAGAGGCGGG + Intronic
1005445230 6:25915829-25915851 TTGCAGCAGCAATAAAAGGCAGG + Exonic
1007082506 6:39117818-39117840 TAGGAGAAGCAAGGAGACACAGG + Intergenic
1007577937 6:42938214-42938236 TTGGGGAAGCAAGGGCAGGCTGG + Intronic
1007624790 6:43238841-43238863 TTTAAGAAGCAAAAACAGGCCGG - Intergenic
1007961389 6:45963016-45963038 TAGGAGTAGAAAGAAGGGGCTGG - Intronic
1008014235 6:46500539-46500561 TTGAAGAAGTAGGAGGAGGCTGG - Intergenic
1009836638 6:69009539-69009561 TTGGAGAGACAGGAAGTGGCTGG + Intronic
1010298580 6:74231140-74231162 TTGGAGAAGTCAGGAGAGTCAGG + Intergenic
1011041877 6:83038704-83038726 TTGGACTATCAAGAAGTGGCTGG - Intronic
1011335929 6:86259687-86259709 TAGGAGAAGAAAGAAGGGTCAGG + Intergenic
1011745320 6:90402783-90402805 GTGGAGAGGCAGGAAGAGGGAGG + Intergenic
1012907587 6:105086166-105086188 GTCAAGAAGAAAGAAGAGGCTGG + Intergenic
1014173623 6:118307266-118307288 TTGGAGAAAGAAGGAGAGGCAGG + Intronic
1014690529 6:124558388-124558410 ATGGAGTAGAAAGAAGAGTCCGG - Intronic
1015464414 6:133532958-133532980 TGGGAGAGGTGAGAAGAGGCCGG - Intergenic
1016291045 6:142528284-142528306 TTGGAAAATCAAGATGAAGCAGG - Intergenic
1017019783 6:150130866-150130888 TGGGAGGAGCAGGAAGAGGCTGG + Intergenic
1017099159 6:150832215-150832237 TTGGAGAAGGAAGAAGGGCAGGG - Intronic
1017190828 6:151650977-151650999 TTGGAGGAGGAAGAAGAAGGAGG - Intergenic
1017297357 6:152813614-152813636 TTGGATAAGCAAAAGGATGCTGG + Intergenic
1017853553 6:158328169-158328191 TTGGAGGAGCAGGAGGAGGGAGG + Intronic
1017922213 6:158882494-158882516 GTGTAAAAGCAGGAAGAGGCCGG + Intronic
1018082492 6:160270521-160270543 GTGGAGATGCAGGCAGAGGCTGG + Intronic
1018477437 6:164157642-164157664 ATGGAGAAGGAAAACGAGGCTGG + Intergenic
1018737524 6:166698703-166698725 TTGGAGAGGGAAGAAGCTGCTGG + Intronic
1018959466 6:168437480-168437502 CTTAAGAAGGAAGAAGAGGCCGG + Intergenic
1019198060 6:170293712-170293734 GAGGAGAAGGAAGAAGAGGAAGG - Intergenic
1019322777 7:423104-423126 TAGGAGAAGCACGAAGGGGTGGG + Intergenic
1019769580 7:2875281-2875303 TTCCAGAAGCAGGAAGAGACAGG - Intergenic
1021862228 7:24917207-24917229 ATGGAGAACAAGGAAGAGGCAGG - Intronic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1023057564 7:36302278-36302300 ATGGAGAAGCAAGAAAAGAATGG - Intergenic
1024913207 7:54469873-54469895 TTGGAGAAGCAGCCAGAGCCAGG + Intergenic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1026718831 7:72813470-72813492 TTAGAGAAGCAGTTAGAGGCTGG - Intronic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1027983602 7:85257005-85257027 TTAAAGAAGCAAGAAGAGTAGGG - Intergenic
1028232916 7:88327039-88327061 TTAGAAAAGTAAGAAGAGGAAGG - Intergenic
1028656999 7:93220033-93220055 TTTGAGAAACAGCAAGAGGCAGG + Intronic
1028894193 7:96022564-96022586 TTTTAGAAGAAAAAAGAGGCTGG + Intronic
1028999202 7:97135340-97135362 TTGGAGCAGCTAAGAGAGGCAGG - Intronic
1029413006 7:100427314-100427336 TTTAACAAGAAAGAAGAGGCGGG + Intronic
1030577834 7:111312182-111312204 TTAGAGAAAGAAGAAGAGGTTGG + Intronic
1030861714 7:114639719-114639741 TTTGAGAAGCAACAGAAGGCTGG + Intronic
1031806550 7:126314891-126314913 TTGGAGAAGCATGAATAGATTGG + Intergenic
1033870780 7:145751499-145751521 TTGGAGGGGCAAGATGAGACTGG + Intergenic
1034393345 7:150802033-150802055 AAGGAGAAAGAAGAAGAGGCAGG - Intronic
1035937085 8:3852777-3852799 TTGGAGGAGACAGAAGAGGCTGG - Intronic
1037141509 8:15525885-15525907 TAGGAAAAGAAACAAGAGGCAGG + Intronic
1038115228 8:24546429-24546451 TGGGAGATGCAAGAAGAGGCTGG + Intergenic
1038288870 8:26230787-26230809 TTGGAGAAGGGAGAAAAGGAAGG + Intergenic
1038401206 8:27286345-27286367 TGGGAGAGGGAAGAGGAGGCTGG - Exonic
1038429016 8:27485014-27485036 TTGGAGATGCAAGCAGAGAAGGG + Intergenic
1038502884 8:28060283-28060305 TTGGGGAGGAAAGAAAAGGCTGG - Intronic
1039492745 8:37960119-37960141 TTGCAGAAGAAAGACCAGGCAGG + Intergenic
1040577669 8:48667880-48667902 AGGGAGAAGGAAGAAGAGACAGG - Intergenic
1042063740 8:64850145-64850167 TTCTATAAGCAAGAAGATGCAGG + Intergenic
1042280437 8:67050295-67050317 TAGGAGAAAAAAAAAGAGGCCGG - Intronic
1042325035 8:67519362-67519384 CTGGAGATGCAGGAAGAGGGAGG - Intronic
1042944212 8:74138482-74138504 TTGGAGTAGGAAGGAGAGGTAGG - Intergenic
1043132050 8:76473657-76473679 TTGGAGAAGGAGGAAAAGGAGGG - Intergenic
1043379132 8:79684068-79684090 TCTGAGAAGCAGGAGGAGGCAGG - Intergenic
1043526625 8:81104701-81104723 GGGGAGAAGCAAGGAGAGGATGG - Intronic
1043609651 8:82046211-82046233 TTGTAGAAGCAGGAAGAGAGTGG - Intergenic
1044401958 8:91783077-91783099 TTTGAGAATCAGGAAGAGACAGG - Intergenic
1044822978 8:96170148-96170170 TGGGAGAAAGAAGAGGAGGCGGG - Intergenic
1045476436 8:102556721-102556743 CTGGAGAAGAGAGAAAAGGCTGG + Intronic
1046724827 8:117663014-117663036 TTGGAGAAGCAAATAAAGGCAGG + Intergenic
1047884655 8:129235879-129235901 ATGGAGAACCAAGAAAAGCCTGG - Intergenic
1048079187 8:131106447-131106469 ATGGAGAAGCAATAAGAGAAGGG - Intergenic
1048829605 8:138463470-138463492 ATGGTGAAGCAGGAAGAGCCTGG + Intronic
1049401710 8:142430662-142430684 TTGCAGCAGGAAGAAGAGGGAGG + Intergenic
1049885803 9:25377-25399 TTGCAGAGGAAAAAAGAGGCTGG + Intergenic
1050283287 9:4074894-4074916 TTGGAGAAGAAAGAAGATCATGG - Intronic
1052380906 9:27770023-27770045 TTGTAGAAGCAAAGAAAGGCAGG + Intergenic
1052418654 9:28211640-28211662 TTGAAGAAGTCAGAAGAGACAGG + Intronic
1053118472 9:35526311-35526333 TTGGAGAAACATGAAAAGACTGG - Intronic
1055433906 9:76272881-76272903 TTGGAGAAGCAAGAAGAGGCAGG - Intronic
1055922205 9:81472766-81472788 TTTGAGAACTAAGCAGAGGCCGG + Intergenic
1056344165 9:85673641-85673663 TTGGAGATACAAAAAGTGGCAGG + Intronic
1056589619 9:87955634-87955656 TTAGAGAGACAGGAAGAGGCAGG - Intergenic
1057089397 9:92243136-92243158 TTGGAGAAGATAGGAGAGGCAGG - Intronic
1057240026 9:93399944-93399966 ATGGAGAAGGAAGAATAGACTGG - Intergenic
1057480234 9:95439557-95439579 GAGGAGAAGCAAGACAAGGCAGG - Intergenic
1057489347 9:95509231-95509253 TTGGAGAAAGAAGAGGAGGAGGG + Intronic
1058178494 9:101767108-101767130 GTGGAGAAGCAGGGAGATGCAGG + Intergenic
1060378049 9:123136339-123136361 TTTGAGAAGAAAGATAAGGCTGG + Intronic
1060816733 9:126639075-126639097 TTGGAGAGGAGAGAAGAGGCTGG + Intronic
1060926456 9:127458831-127458853 TTTGAGAAGGAAAATGAGGCGGG + Intronic
1060989795 9:127841892-127841914 TTGGAGAAGGAAACTGAGGCTGG - Intronic
1061119895 9:128636034-128636056 GTGGAGAGGCCAGAAGAGGCAGG - Intronic
1061179511 9:129015701-129015723 GTGAAGAAACAATAAGAGGCTGG + Intronic
1061554740 9:131360301-131360323 TTATAAAAGAAAGAAGAGGCTGG + Intergenic
1061613627 9:131764748-131764770 GTGGAGAAGGAGGAAGAGGAGGG - Intergenic
1062050283 9:134443531-134443553 CTGGAGGAGCAAGAAGGGACTGG - Intergenic
1062150169 9:135014024-135014046 TTGGAGAAGGAAGAGGATTCTGG - Intergenic
1185760543 X:2687337-2687359 TTTGAGGAGCAAGAGGATGCTGG - Intergenic
1185815174 X:3148334-3148356 TTGGAGAAGAAAGATGAAGAGGG + Intergenic
1185937874 X:4279541-4279563 ATTGAGAAGGAAGAAGAGGAGGG - Intergenic
1186952132 X:14638181-14638203 TTGGAGAAGTATGAAAAGGAAGG + Intronic
1187217092 X:17287786-17287808 TTGGAAAAGCAAAAACAAGCAGG + Intergenic
1187381666 X:18807482-18807504 TTGTAAGAGCAAGAAGAGGGTGG - Intronic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1188156620 X:26749169-26749191 TAGGAGAAGCAAGTAGGGGTGGG - Intergenic
1188520596 X:31033695-31033717 TGGAAGAAGAATGAAGAGGCAGG - Intergenic
1189752232 X:44234056-44234078 TGGAAGGAGCCAGAAGAGGCTGG - Intronic
1189834007 X:45002868-45002890 TTGGAGAAGAATGAAAAGGGGGG - Intronic
1190042117 X:47079858-47079880 TGGGAGAAGGATGAAGATGCAGG + Intronic
1190788424 X:53676438-53676460 GTAGAGAAGAATGAAGAGGCAGG + Intronic
1191021226 X:55862498-55862520 ATGGAGAATCCAGGAGAGGCAGG + Intergenic
1192258447 X:69486667-69486689 TGGGGGAAACTAGAAGAGGCTGG - Intergenic
1192550718 X:72051570-72051592 TAGGAGAAGCAAGAGGAAGGAGG - Intergenic
1193264423 X:79452081-79452103 TTGGTGAAGCAAGAGAAGACAGG + Intergenic
1193574938 X:83185390-83185412 TTGGAGAAGCAAGGAACTGCAGG + Intergenic
1193794238 X:85853519-85853541 TTGGAGTAGACAGAAGAGCCTGG + Intergenic
1195421702 X:104682702-104682724 TGGAAGAAGCTAGAAGAAGCTGG + Intronic
1195696773 X:107673289-107673311 CTGGAGAATCTGGAAGAGGCAGG - Intergenic
1197880265 X:131159009-131159031 TTGGGGAAGCAAGACAAGGATGG - Intergenic
1199704886 X:150415509-150415531 TTGCATAAGCAAAAAGAGGAAGG + Intronic
1200118686 X:153780566-153780588 TAGAAGAAGCAGGAAGTGGCTGG + Intronic
1200231602 X:154446488-154446510 CTGGAGGAGGAAGAAGAGGGAGG + Exonic
1200426159 Y:3022606-3022628 ATGGAGAATCTAGAACAGGCAGG - Intergenic
1201526029 Y:14935465-14935487 ATGGAGAAGGAAGGAGAGACAGG - Intergenic
1201721396 Y:17101688-17101710 ATTGAGAAGGAAGAAGAGGAGGG - Intergenic