ID: 1055434344

View in Genome Browser
Species Human (GRCh38)
Location 9:76277273-76277295
Sequence CTGAAGCCTTCATTCTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 224}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055434344_1055434348 29 Left 1055434344 9:76277273-76277295 CCCCCAAAGAATGAAGGCTTCAG 0: 1
1: 0
2: 0
3: 18
4: 224
Right 1055434348 9:76277325-76277347 CGTTAGTGAGTGATCCCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055434344 Original CRISPR CTGAAGCCTTCATTCTTTGG GGG (reversed) Intronic
900428983 1:2593160-2593182 CTGAAGCCCTCCTTCTCTGGGGG - Intronic
900819906 1:4878712-4878734 GTGCAGCCTTCAGTCTGTGGTGG - Intergenic
902063201 1:13662603-13662625 CTGAATCCTCTTTTCTTTGGGGG - Intergenic
903778168 1:25806285-25806307 CTTTGGCCTTCATTCTATGGTGG + Intronic
903878446 1:26492264-26492286 ATGAAGCCTACATTCTATGAGGG + Intergenic
905271168 1:36788689-36788711 CTGAAGCCTTCAGTCTCAGATGG + Intergenic
905463914 1:38138854-38138876 CCAAACCCCTCATTCTTTGGAGG + Intergenic
905593276 1:39183803-39183825 CTGAGGCCTTCTTTCTTGGGAGG + Intronic
906197865 1:43940183-43940205 CTGAAGCCTTCATAATTTTTTGG + Intergenic
906478922 1:46187776-46187798 CTGACGCCTTCAGTGTTTGTTGG - Intergenic
908632762 1:66128550-66128572 TTGAAGGCTTCATTCTTTATTGG + Intronic
915077636 1:153323123-153323145 CTGTAGCCTTTATACTTTGAAGG - Intergenic
915541256 1:156567931-156567953 CTAATGCCTTCATTCATTGTTGG - Intronic
920244204 1:204575824-204575846 TTGAAGCCTTCTTTCTTTAGTGG + Intergenic
923290076 1:232536549-232536571 CTAAAGGCTTCTTTATTTGGTGG - Intronic
924418489 1:243884502-243884524 CTGAAAACTTGTTTCTTTGGTGG - Intergenic
924905328 1:248446133-248446155 CTGAAGACTTCATGCTTGGAGGG + Intergenic
924922560 1:248645927-248645949 CTGAAGACTTCATGCTTGGAGGG - Intergenic
1065498628 10:26355828-26355850 CTGAATGCTGCATTCTGTGGAGG + Intergenic
1067065682 10:43102846-43102868 CTGCAGCTTTCATTCTTGTGGGG + Intronic
1067137823 10:43626845-43626867 CTGGAGCCTTCATACATTGTTGG + Intergenic
1068142298 10:53024005-53024027 ATGAATCCTTACTTCTTTGGAGG - Intergenic
1073152223 10:101319850-101319872 CTTAGGCTTTCTTTCTTTGGGGG + Intergenic
1073662889 10:105496908-105496930 CTGGAGCCTGGATTCTATGGAGG - Intergenic
1074220349 10:111430520-111430542 GTGCAGCCTTCAGTCTGTGGTGG - Intergenic
1074240500 10:111634245-111634267 CAGAAGCCATCAGTCTTTGTGGG - Intergenic
1078580806 11:12538306-12538328 CTGAAGTCTTCATTCTCTCCAGG + Intergenic
1079182814 11:18208860-18208882 GTGTAGCCTTCAGTCTGTGGTGG - Intronic
1079482334 11:20894645-20894667 CTGGAGCCTTCATTCACTGCTGG + Intronic
1083398847 11:62410215-62410237 CTCAAGCCTTCATTCTGTTAAGG - Intronic
1084350995 11:68599244-68599266 CTGAATCCTCAATTCTTTGCTGG - Intronic
1084649595 11:70481139-70481161 CTGACGCCTCCATTCTTGGCAGG + Intronic
1084921512 11:72474525-72474547 CTGAAGCCTGGATTCAGTGGTGG + Intergenic
1088344230 11:108804757-108804779 CCGAAGCCTTCACTTTTTGCTGG + Intronic
1089880457 11:121768433-121768455 GTGCAGCCTTCAGTCTGTGGCGG + Intergenic
1090000383 11:122951323-122951345 CTGAAGCAGTCATTTTGTGGTGG - Intronic
1091651311 12:2312283-2312305 CTGAAGTCTTTCTCCTTTGGGGG - Intronic
1094717350 12:33026081-33026103 CTGAGGCCTTCTTTCTGTCGAGG - Intergenic
1094776044 12:33729060-33729082 CTGGATTCTTCATTTTTTGGAGG + Intergenic
1095693915 12:45122350-45122372 CACAAACCTTCATTCTTAGGAGG - Intergenic
1095860731 12:46915158-46915180 CTGAATCCTTAATTATTTGTGGG - Intergenic
1097502015 12:60415704-60415726 GTGAAAACTGCATTCTTTGGAGG - Intergenic
1098873265 12:75840371-75840393 CTGAAGCCTCCAAACTGTGGGGG + Intergenic
1099203046 12:79697482-79697504 CTGAAGCTTACATAATTTGGTGG + Intergenic
1099906699 12:88779610-88779632 CTGAAAATTTCATTCTTTTGGGG + Intergenic
1100074649 12:90765243-90765265 CTGCAGCCTTCAGTCTGTGGCGG - Intergenic
1101621823 12:106396012-106396034 CTGAAGCCTTCTTTCTGTGTTGG + Intronic
1103759600 12:123238937-123238959 TTGAAGCCTTCATATTTAGGGGG + Intronic
1104412009 12:128566353-128566375 CTGAAACCTATATTGTTTGGGGG + Intronic
1106765445 13:32908924-32908946 ATTAAACATTCATTCTTTGGAGG - Intergenic
1107420542 13:40242217-40242239 CTGAAGCCTACCTACTTTGTGGG - Intergenic
1110313339 13:74076436-74076458 CTTGACCCTGCATTCTTTGGAGG + Intronic
1110468476 13:75830086-75830108 CTGAAGCTTGGATTCTTTGTAGG + Intronic
1112972044 13:105273234-105273256 CTGAACCCTTCAGTCGGTGGTGG - Intergenic
1112974953 13:105305708-105305730 CTGAAGGATTCATTGTGTGGTGG - Intergenic
1114676068 14:24441084-24441106 CTGAAGCGTTCCTTCCCTGGAGG + Exonic
1115655949 14:35443817-35443839 CTTAAGCCTTCTTTTTTTCGGGG + Intergenic
1116665219 14:47766051-47766073 GTGCAGCCTTCAGTCTGTGGTGG + Intergenic
1116982791 14:51189105-51189127 CAGTGGCCTTCATTTTTTGGGGG + Intergenic
1117561137 14:56940066-56940088 CTGGAGCCTTCATTCGTGGCTGG - Intergenic
1119474936 14:74921660-74921682 CTGACCCCTTCAGTCTTTGGAGG - Intronic
1119533595 14:75381457-75381479 CTGAAACCTCAATTCTTTGATGG - Intergenic
1119944573 14:78679175-78679197 CTGTAGGCTTCCCTCTTTGGAGG + Intronic
1120174797 14:81281548-81281570 CTGAAGTCCTTTTTCTTTGGAGG + Intronic
1120721797 14:87897469-87897491 CTGAGCCCTTCATTCACTGGAGG + Intronic
1122459576 14:101884055-101884077 GTGCAGCCTTCAGTCTGTGGCGG + Intronic
1122511948 14:102276160-102276182 CTGGAACTTTCATTCTTTGCCGG + Intronic
1126235818 15:46382893-46382915 CTGAGGCCTTAATTCTTTCAAGG + Intergenic
1129128716 15:73470342-73470364 CTGCACTCTTCATTCTTTTGTGG + Intronic
1129437615 15:75554744-75554766 TTTAAGACTTCATTCTTTGTAGG - Intronic
1130973630 15:88755909-88755931 GTGCAGCCTTCAGTCTGTGGCGG + Intergenic
1131795581 15:96012729-96012751 CAGAAGCCCTCATTCTTCGTTGG - Intergenic
1132207926 15:99999199-99999221 CTGAAGCTTACATTCTGAGGGGG + Intronic
1132746631 16:1438928-1438950 CCGAGGCCTTCATTCTCTGTGGG + Exonic
1133407226 16:5534438-5534460 CTGCAGCCTTCAGTCTGTGGTGG + Intergenic
1133665781 16:7966410-7966432 GTGCAGCCTTCAGTCTGTGGCGG - Intergenic
1135684828 16:24490453-24490475 GTGGAGCTTTCATTCCTTGGAGG - Intergenic
1136687873 16:32006097-32006119 CTGAAGTTTTCATTGTTGGGGGG - Intergenic
1136788475 16:32949652-32949674 CTGAAGTTTTCATTGTTGGGGGG - Intergenic
1136881339 16:33904279-33904301 CTGAAGTTTTCATTGTTGGGGGG + Intergenic
1137015332 16:35368578-35368600 CTGAAACCTGCATGCTTGGGTGG + Intergenic
1138033917 16:53583241-53583263 GTGCAGCCTTCAGTCTGTGGCGG - Intergenic
1140523162 16:75599532-75599554 TTGTTGCCTTCATTCTTTGCTGG + Intronic
1140884393 16:79230027-79230049 CTGAATCCTTCATTCTTAAGAGG + Intergenic
1142116995 16:88363354-88363376 CTGGAGGCATCACTCTTTGGAGG - Intergenic
1203090672 16_KI270728v1_random:1211146-1211168 CTGAAGTTTTCATTGTTGGGGGG - Intergenic
1146041197 17:29456401-29456423 CTGAAGTTTTCTTTCTTGGGAGG + Intronic
1149915652 17:60606509-60606531 TTGAAGCCTTCATACCTTGCTGG - Intronic
1150167237 17:62955677-62955699 GTGCAGCCTTCAGTCTGTGGCGG - Intergenic
1150430401 17:65111279-65111301 CTGAGGCCTTAAATCTGTGGAGG - Intergenic
1151337195 17:73446937-73446959 CTGAAGCCAGTTTTCTTTGGAGG - Intronic
1151656743 17:75499715-75499737 TTGAAGCCAACCTTCTTTGGAGG + Exonic
1151915967 17:77118220-77118242 CTGAAGCCTTCTTACCTAGGCGG + Intronic
1152866374 17:82726210-82726232 TAGAAGCCTTCATTCTTGGAAGG + Intronic
1153167746 18:2281781-2281803 CTGAAGCCTTCCTTATTTCCAGG - Intergenic
1155236199 18:23821831-23821853 CTGAAGCAGTCTCTCTTTGGTGG + Intronic
1156926341 18:42585092-42585114 CAAAAGCATTCAGTCTTTGGAGG + Intergenic
1157667414 18:49499366-49499388 CTGAGTCCTTCATTCCTGGGAGG + Intergenic
1157949177 18:52015377-52015399 CTGTGGCCTTCCTTCTTTGGAGG + Intergenic
1158152502 18:54388400-54388422 CTTAATGCTGCATTCTTTGGAGG + Intergenic
1159856370 18:73594443-73594465 CTGAAGTCCTTATCCTTTGGAGG - Intergenic
1164602850 19:29575261-29575283 TTGAAGCTTACATTTTTTGGGGG - Intergenic
1164695145 19:30238184-30238206 CTGAAGCCCACAGCCTTTGGTGG - Intronic
1164765927 19:30769553-30769575 TTGAAGCCCTCATTCATTGTTGG - Intergenic
925790706 2:7483984-7484006 CTTAACCCTTCATTCATTGAAGG - Intergenic
925869013 2:8253236-8253258 CTAAAGCCATCCATCTTTGGTGG + Intergenic
927743420 2:25592154-25592176 CTCCAGCCTTCATTATTTTGGGG + Intronic
927988657 2:27431337-27431359 CTGAAGTTTCCATTCTCTGGGGG - Intronic
928918032 2:36494821-36494843 TTCAAGCCTTCTTCCTTTGGAGG + Intronic
933027689 2:77282175-77282197 CTGGATACTTCATTTTTTGGTGG + Intronic
934982910 2:98861455-98861477 CTGGAGCCTTCATTCATTGCTGG + Intronic
937857899 2:126685976-126685998 CTGAATTCTTCCTTCTTTGCTGG + Intronic
939832460 2:147089183-147089205 GTGCAGCCTTCAGTCTGTGGTGG + Intergenic
941278994 2:163526488-163526510 ATGAAGCCTTCATACATTGTTGG + Intergenic
941898107 2:170651093-170651115 CTGATGCATGCAGTCTTTGGAGG - Intronic
943118166 2:183699939-183699961 CTGAAGCTTTCATTCTAATGAGG + Intergenic
943826749 2:192404573-192404595 TTGCAGCATACATTCTTTGGTGG + Intergenic
944419770 2:199517207-199517229 CTGAAGCTCTCATTCTCTGCTGG - Intergenic
945577292 2:211548036-211548058 CTGAAGCCTTAATTATTTCCTGG - Intronic
946647907 2:221858825-221858847 CTGAAGCCTTCATACATGGTTGG - Intergenic
948300576 2:236903811-236903833 CTGAAGCCGCGACTCTTTGGAGG + Intergenic
1169354197 20:4894003-4894025 CTGCAGCCGTCATTCTTTTGTGG - Intronic
1173524534 20:43721672-43721694 CTGCAGCCTGCATTCTCAGGCGG - Intergenic
1177663670 21:24123006-24123028 CTTCAGCCTTCAGTCTGTGGCGG - Intergenic
1182282702 22:29226415-29226437 CAGAACCCTTCAGTCTCTGGGGG - Intronic
1183684398 22:39353230-39353252 CTGAAGCTTACATGATTTGGGGG - Intronic
952002515 3:28802690-28802712 CTGAAGGCTTCAGAGTTTGGAGG + Intergenic
952015958 3:28958366-28958388 CAGAAACATTCATTCTTTGCTGG - Intergenic
956153346 3:66267069-66267091 CTGAAGCATTCACTTTCTGGCGG + Intronic
957749035 3:84388374-84388396 TTGAACTCTTCATTTTTTGGAGG + Intergenic
958028083 3:88072750-88072772 CTGATGCTTTCATTTTTTTGTGG - Intronic
958731937 3:97969320-97969342 CTGAAGCCTTAATTCTTTCCTGG - Intronic
958894527 3:99815118-99815140 CTGACCCCTGCAGTCTTTGGAGG - Intergenic
962314871 3:134353094-134353116 CTGAAGCCTGTATAATTTGGAGG - Intergenic
962399357 3:135043937-135043959 CTGAAGACTCCACTCTTTGCAGG + Intronic
963115422 3:141724758-141724780 CTGAAGCTTTCTTTCTTTTTTGG - Intergenic
964504361 3:157382261-157382283 CTTAATCTTTCATTCTTTGAAGG - Intronic
965885306 3:173438066-173438088 CTGAAGGATTCATTCATTTGGGG + Intronic
968004125 3:195227796-195227818 CTGATGTCTTCATCCTTTGTTGG - Intronic
968327425 3:197831134-197831156 CTGAAGCCTACAATCTGAGGTGG + Intronic
968335073 3:197906732-197906754 CTGCAGAGTTCATTCTTTGGGGG + Intronic
969311920 4:6357823-6357845 CTGCAGACTTCACTCTTGGGTGG - Intronic
970317809 4:14846092-14846114 CTCAAGGCTTCATTCTTAAGTGG + Intergenic
971124860 4:23742438-23742460 CTGAAGCCTTCATCCTTCAGGGG - Intergenic
971211472 4:24621875-24621897 AGGAAGACTTCTTTCTTTGGAGG + Intergenic
972847646 4:43009074-43009096 CTCAAGCTTGCCTTCTTTGGAGG + Intronic
972912216 4:43831405-43831427 CTGAATTCTTTATTCTATGGAGG + Intergenic
973122143 4:46534697-46534719 TTGATGCCTTCCTTCTTTTGTGG - Intergenic
977996937 4:103505643-103505665 CTGAAGCCTCGCTTCTTGGGGGG - Intergenic
978539771 4:109804273-109804295 CTGATTCTTTCACTCTTTGGAGG - Intergenic
978711722 4:111790438-111790460 CTGAAGACATATTTCTTTGGTGG + Intergenic
981337220 4:143581232-143581254 CTGAACCCTTTAGTCATTGGCGG + Intronic
982789812 4:159577652-159577674 CTAAGGCCTTAATTCTTTGATGG + Intergenic
984432776 4:179669099-179669121 GTGCAGCCTTCAGTCTGTGGTGG - Intergenic
986211418 5:5676614-5676636 CTAAAGCCTTTGTTCTTTTGGGG + Intergenic
986243349 5:5981392-5981414 CTGAAGCCTTTGCACTTTGGTGG - Intergenic
986547291 5:8912339-8912361 GTGCAGCCTTCAGTCTGTGGTGG + Intergenic
987167852 5:15219768-15219790 CTGAGGCCAGCATTCTTTGTTGG + Intergenic
989125511 5:38048909-38048931 ATGAAGCATTCAAACTTTGGAGG - Intergenic
989168039 5:38449528-38449550 CCCAAGCCTTCAGTCTCTGGGGG + Intronic
990245072 5:53856513-53856535 GTGCAGCCTTCATTCTGTGGTGG + Intergenic
990303481 5:54472506-54472528 CTTAATCCTTCATGCTCTGGGGG + Intergenic
992272290 5:75077481-75077503 TTTAAGCCCTCACTCTTTGGGGG + Intronic
993583871 5:89699116-89699138 CTGAAGCCCCCATTTCTTGGGGG - Intergenic
993658285 5:90599081-90599103 CTTAAGCCTCTACTCTTTGGGGG - Intronic
995655174 5:114418332-114418354 CTGAAGCCTTCCTTATGTGCTGG + Intronic
996541679 5:124636391-124636413 ATGGAGCTTTCATTTTTTGGTGG - Intergenic
996789742 5:127280313-127280335 TTGATGCCTCCATTCATTGGAGG + Intergenic
998336592 5:141377112-141377134 CTGAAGTCTTAATTTTGTGGGGG + Intronic
1007075076 6:39061055-39061077 CTGGAACCCTCATTCCTTGGAGG - Intronic
1009961595 6:70529504-70529526 TTGAAGACTTTATTGTTTGGAGG - Intronic
1011658091 6:89569706-89569728 CTGAAACCTTCATACATTGCTGG - Intronic
1011878875 6:91997896-91997918 CTGAGGGCTGCATTCTCTGGAGG - Intergenic
1012341583 6:98131701-98131723 CTAAAGCCTTCATTGATTTGGGG - Intergenic
1012359157 6:98355242-98355264 CTGAATCCTTCATTAATTGGTGG - Intergenic
1015770999 6:136768569-136768591 CTGGAACCTTCATTCATTGTTGG + Intronic
1020836905 7:13164850-13164872 GTGAAATCTTCATTCTTTGAGGG - Intergenic
1021569027 7:22045673-22045695 GTGCAGCCTTCAGTCTGTGGTGG - Intergenic
1023344048 7:39252957-39252979 CTGGAGCTTACATTCTTTGGGGG - Intronic
1023493783 7:40772320-40772342 TAAAAGCCTTTATTCTTTGGAGG + Intronic
1023710065 7:42982689-42982711 CTGTGGACTTTATTCTTTGGGGG - Intergenic
1024221573 7:47292529-47292551 CTGAAGCCTTCTTTGTCTGAGGG + Intronic
1024472866 7:49781840-49781862 CTCAAGACTTCATCCTTTGAAGG - Intronic
1024971476 7:55075319-55075341 CTGAACCCTTCTTTGTATGGAGG + Intronic
1026321517 7:69272162-69272184 CTGAAACCTTTATTCTCTGAGGG + Intergenic
1027523905 7:79243984-79244006 CTGTAGCCCTCAGCCTTTGGTGG + Intronic
1027970273 7:85071254-85071276 TTGAATCCATCATTCTTTGTTGG - Intronic
1030262207 7:107578112-107578134 ATTAAGCTTTCAATCTTTGGAGG - Exonic
1030834880 7:114270435-114270457 CAGAAACCTTCATTCATTGTTGG - Intronic
1031361118 7:120849920-120849942 ATCAAGCCTTGATTATTTGGAGG + Intronic
1031382152 7:121100065-121100087 GTGAAGCGTTTTTTCTTTGGTGG - Exonic
1031817889 7:126461661-126461683 CAGTTGCCTTCATTCATTGGAGG + Intronic
1031935252 7:127729530-127729552 CTGTAGGTTTCATTCCTTGGTGG + Intronic
1032925476 7:136599332-136599354 ATTAAGCCTTTATTCTTTGAGGG - Intergenic
1033389870 7:140916748-140916770 CTGAAGTCTTAAGTATTTGGGGG + Intronic
1035176631 7:157056486-157056508 CTGGAGACTTCTTTCTTTGTTGG + Intergenic
1036628774 8:10495905-10495927 CTGAAACCGTCCTTCTTTGTTGG + Intergenic
1036650729 8:10641760-10641782 CTTAAGTCTTCATTCTTTGAAGG - Intronic
1036711536 8:11082595-11082617 CTGAATCCCCCATTATTTGGAGG - Intronic
1036805208 8:11826933-11826955 CTGCAGAATTCTTTCTTTGGGGG - Intronic
1038509407 8:28116797-28116819 CTGAAGTCTTCAAACTTTAGAGG + Intronic
1038650650 8:29400179-29400201 CTGAATGTTTCTTTCTTTGGAGG + Intergenic
1041165059 8:55083523-55083545 CTGGAAAATTCATTCTTTGGAGG + Intergenic
1042164174 8:65929739-65929761 CTGAATCCTTCCTTTTCTGGAGG - Intergenic
1045113970 8:98962261-98962283 TTTAAGCTTTCATTCTTTAGGGG - Intergenic
1046128389 8:109939485-109939507 CTCAAGCCTTCATTCCTGAGGGG + Intergenic
1047726008 8:127684534-127684556 AAGAATCCTTCTTTCTTTGGAGG + Intergenic
1047758960 8:127939968-127939990 CTGAACCCTGCATTTTGTGGAGG + Intergenic
1048286963 8:133149320-133149342 CTGAATCCTGCATTGTTGGGAGG + Intergenic
1049082436 8:140453928-140453950 CCGAAGCCTTCATTCTACAGAGG + Intronic
1053655320 9:40213448-40213470 AGGAAGCCATCATTCTTTAGAGG + Intergenic
1054367437 9:64359662-64359684 AGGAAGCCATCATTCTTTAGAGG + Intergenic
1054529280 9:66162867-66162889 AGGAAGCCATCATTCTTTAGAGG - Intergenic
1054675063 9:67849401-67849423 AGGAAGCCATCATTCTTTAGAGG + Intergenic
1055282385 9:74689421-74689443 CTTCAGCTTTCAGTCTTTGGGGG - Exonic
1055434344 9:76277273-76277295 CTGAAGCCTTCATTCTTTGGGGG - Intronic
1055682768 9:78734944-78734966 CTGAAACACTCATACTTTGGTGG - Intergenic
1056062052 9:82893881-82893903 TTGAAACCTTTTTTCTTTGGTGG - Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057372273 9:94484966-94484988 AGGAAGCCATCATTCTTTAGAGG + Intergenic
1060023854 9:120154753-120154775 CTGAAGCACTCACTCTGTGGGGG - Intergenic
1060957559 9:127653826-127653848 CTGGAGCCTTCTCTCTGTGGCGG + Intronic
1185843182 X:3412361-3412383 CTGAAGCCTTCAGTGTTTAAAGG - Intergenic
1187245706 X:17551290-17551312 CAGATCCCTTCATTCTTTGTAGG - Intronic
1188317361 X:28691027-28691049 CTGAAGGTTTGAATCTTTGGAGG - Intronic
1188609159 X:32074710-32074732 CAGAAGCCTTTTTTCTTTGAAGG - Intronic
1191962294 X:66717007-66717029 CAGAAGCCTTCATTCATTCCTGG + Intergenic
1192083197 X:68068142-68068164 TTGGAGCCTTCATTCATTGCTGG + Intronic
1192506115 X:71684815-71684837 CTGGAGCCTTTAATCCTTGGGGG + Intergenic
1192520582 X:71796733-71796755 CTGGAGCCTTTAATCCTTGGGGG - Intergenic
1192756103 X:74048428-74048450 CTGTAGCTTTCATACTTGGGAGG + Intergenic
1194099898 X:89690744-89690766 CTGAAGTTTTCTTTCTTTGTCGG + Intergenic
1194966875 X:100298282-100298304 CTGTACACTTCATTATTTGGAGG + Intronic
1195238747 X:102929415-102929437 CTGGATCTTTCATCCTTTGGAGG + Intergenic
1196230681 X:113217535-113217557 ATGCAGCCTTCAGTCTGTGGCGG + Intergenic
1196512951 X:116533683-116533705 TTGGAGCCTTCATACATTGGTGG + Intergenic
1197149528 X:123204877-123204899 AAGAAGCCCTCAGTCTTTGGTGG + Intronic
1197873019 X:131077492-131077514 CTACAGCCTTCATGATTTGGAGG - Intronic
1198839556 X:140841738-140841760 CTGATGCCTGCTTTTTTTGGGGG + Intergenic
1200015880 X:153163528-153163550 GTGCAGCCTTCAGTCTGTGGTGG + Intergenic
1200452901 Y:3352108-3352130 CTGAAGTTTTCTTTCTTTGTCGG + Intergenic
1201232013 Y:11874218-11874240 CTGAAGCCTTCAGTGTTTAAAGG + Intergenic
1201502409 Y:14659557-14659579 CTGAAGCCCTTGTTCTGTGGAGG - Intronic