ID: 1055440189

View in Genome Browser
Species Human (GRCh38)
Location 9:76329477-76329499
Sequence GAAACATTTCATATTAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 300}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055440189 Original CRISPR GAAACATTTCATATTAAAGG AGG (reversed) Intronic
901372387 1:8810761-8810783 GAAACATTTTATACTATAGAGGG - Intronic
902531673 1:17094567-17094589 GAAACACTCCATATTTAATGTGG + Intronic
903468694 1:23569431-23569453 CAAACATCTCATTTTACAGGTGG - Intergenic
905969177 1:42128156-42128178 GCAATATTTAATATTATAGGAGG + Intergenic
906990601 1:50733517-50733539 GATACAATTCAGGTTAAAGGAGG + Intronic
908414152 1:63896438-63896460 GAAATCTTTCAGAGTAAAGGAGG - Intronic
910529128 1:88215227-88215249 AAAACATTACATTTTAAAAGTGG - Intergenic
911132397 1:94402716-94402738 GAAATGTTCCAGATTAAAGGAGG - Intergenic
911485200 1:98496916-98496938 TAAACATTTAATTTTAAAGGTGG - Intergenic
913716457 1:121539299-121539321 GAAACATTTCATCTTAACAGAGG - Intergenic
917478455 1:175389074-175389096 GTAACATTTCATATCAGAAGAGG + Intronic
918155981 1:181847150-181847172 GAAAAATTACATATAATAGGAGG + Intergenic
918363018 1:183778527-183778549 GAAACATATCATATAAAATAAGG - Intronic
918876459 1:190051639-190051661 GAAACATTGTATATTTAAAGGGG - Intergenic
919962095 1:202481606-202481628 GACACATTACATATTTATGGAGG + Intronic
921061640 1:211590219-211590241 GAAATGTTCCAGATTAAAGGAGG - Intergenic
921293438 1:213680080-213680102 GAAAAATTTCACGTTAAAGAAGG + Intergenic
924186757 1:241500208-241500230 GATACATTTCAAATAAAATGAGG + Intronic
924371544 1:243356136-243356158 GACATGTTTCATTTTAAAGGCGG + Intronic
924720517 1:246618747-246618769 GTAACATTGAATATTAAAGTAGG + Intronic
1063574636 10:7250816-7250838 AAAACATTTATTTTTAAAGGTGG + Intronic
1065537140 10:26726257-26726279 GAAACATTTCATTTTTAATAAGG - Intronic
1066761625 10:38759680-38759702 GAAACATTTTATAATACAGAGGG - Intergenic
1066959966 10:42212741-42212763 GAAACATTTTATAATACAGAGGG + Intergenic
1068288129 10:54965706-54965728 GAAATGTTTCAAATTAAATGTGG - Intronic
1068337438 10:55653614-55653636 ATAACATTTCAATTTAAAGGAGG - Intergenic
1068571582 10:58635658-58635680 TAAACATTTGATGTCAAAGGTGG - Intronic
1068669295 10:59708501-59708523 ATAACAGTTCATATTGAAGGTGG - Intronic
1069247983 10:66231458-66231480 GAAACATTTCATGGGGAAGGGGG + Intronic
1070667638 10:78356662-78356684 AAAACATTTCATGTCAAGGGTGG + Intergenic
1070906081 10:80074393-80074415 GTAACATTTCAAATTAAGGAAGG - Intergenic
1072763100 10:98074177-98074199 GAAACACATGATATTAAAGGTGG - Intergenic
1078181098 11:9011526-9011548 GAAATGTTCCAGATTAAAGGAGG - Intergenic
1081047379 11:38293335-38293357 GGAACATTGCATATTATAGATGG + Intergenic
1081515320 11:43823142-43823164 AAACCATTTCTTATTAAGGGTGG + Intronic
1082033272 11:47622900-47622922 GAAACAAATCATATTGAAGCAGG + Intronic
1082245618 11:49918874-49918896 GAAACATTTTCTATTATAGGGGG - Intergenic
1083128298 11:60595882-60595904 GAAACATATCATATTCAAGAGGG + Intergenic
1083139834 11:60712856-60712878 AGAACATTTCATAGTGAAGGTGG - Intronic
1083873213 11:65504903-65504925 CAAACATTCCATTTTAAATGTGG + Intergenic
1084611313 11:70204791-70204813 GATAAATTGCATTTTAAAGGCGG + Intronic
1085845215 11:80057212-80057234 GAAACACTTCATTTTAATGTGGG - Intergenic
1085985500 11:81782490-81782512 GAAAAATCTCATCTTGAAGGTGG + Intergenic
1086171402 11:83840533-83840555 GACACATTTCATCTAAAAGGGGG + Intronic
1086302540 11:85443464-85443486 GAAACATAGAATATTAAAGTTGG - Intronic
1086308726 11:85511646-85511668 GAAACATTTAATCTTAATGAAGG - Intronic
1086547441 11:88014580-88014602 GTAACAAGTCATATTAATGGTGG + Intergenic
1086588524 11:88484494-88484516 GAAACGTTATAAATTAAAGGTGG + Intergenic
1092115953 12:6005629-6005651 GCAACTTTTCATATAAAAGGGGG + Intronic
1092470698 12:8777357-8777379 AAAACATTTCAAATTAAACCTGG - Intronic
1092512563 12:9172116-9172138 GAAACATATCATACTAACAGTGG + Intronic
1092519165 12:9249233-9249255 AAAACAATACATTTTAAAGGAGG - Intergenic
1092941789 12:13416256-13416278 TAAAAACTTCATATAAAAGGGGG + Intergenic
1093055509 12:14552218-14552240 GATACTTTTTATATCAAAGGAGG + Intronic
1093122821 12:15293480-15293502 GAAACATTTCATATAAAATATGG + Intronic
1093276203 12:17130999-17131021 GAAATAATTAATATTAAAGAGGG + Intergenic
1093285045 12:17248719-17248741 GAAACAGTACATATTCAAGAAGG + Intergenic
1094357392 12:29592612-29592634 GAAACATTTAGTATTAAATAAGG + Intronic
1094427670 12:30332402-30332424 AAAATATTTCTTATTAAAGTTGG - Intergenic
1096660034 12:53118547-53118569 GAAGCATCTCATAATAAAGATGG + Intronic
1097140322 12:56897360-56897382 GATTCACTTCCTATTAAAGGTGG + Intergenic
1098148519 12:67522488-67522510 GATACATCTAATCTTAAAGGTGG - Intergenic
1098899993 12:76102638-76102660 GTAACATTTCATTTTCATGGAGG - Intergenic
1099742551 12:86659537-86659559 GAAACATTAAATATTAAATAGGG + Intronic
1100372658 12:93982745-93982767 AAAACACATCATTTTAAAGGTGG + Intergenic
1100424897 12:94475200-94475222 GATCCATTTCATAGTAAAGGTGG - Intergenic
1101321276 12:103675252-103675274 GACACTTTTACTATTAAAGGTGG - Intronic
1101356763 12:103986273-103986295 GACTCATTTGTTATTAAAGGAGG - Intronic
1102863767 12:116358237-116358259 TAAACATTTAAAATTAAAAGTGG + Intergenic
1103861998 12:124022970-124022992 CAAACATTTCAGAATAAATGGGG - Intronic
1105882865 13:24618784-24618806 CACACCTTTCATATTAAGGGTGG - Intergenic
1106237855 13:27880117-27880139 GGAATGTTTCAGATTAAAGGAGG + Intergenic
1107174272 13:37381713-37381735 GAAAAATTTCAGACTAAATGTGG + Intergenic
1109230309 13:59748782-59748804 TAAGCATTTTATATTAGAGGGGG + Intronic
1109660095 13:65445975-65445997 GAAACATATCACAAAAAAGGGGG + Intergenic
1109972974 13:69794449-69794471 GAAACAGAGCATCTTAAAGGTGG + Intronic
1110354958 13:74556818-74556840 GAAAAACTTCATAATAAATGGGG + Intergenic
1111602411 13:90492002-90492024 GAAACATATCATATACAAGAAGG - Intergenic
1111668442 13:91299183-91299205 GAAATGTTTCAGATTAAAGAAGG - Intergenic
1111710044 13:91799569-91799591 AAAACATTTTATAGTATAGGGGG - Intronic
1114262993 14:21052376-21052398 GAAACAGTTAATGCTAAAGGAGG + Intronic
1115396645 14:32916846-32916868 GAGTCATTTCATATTAGAGTTGG - Intergenic
1115570621 14:34663205-34663227 GAGAAATATCATATTAAACGAGG - Intergenic
1118150757 14:63187717-63187739 GAAACTATCCAAATTAAAGGAGG + Intergenic
1118408585 14:65452253-65452275 GAAACACTGTATTTTAAAGGGGG - Intronic
1118804383 14:69222387-69222409 GAAAGATGTCAGATTAAAGTTGG - Intronic
1119986121 14:79139829-79139851 GCAGCATTTAATTTTAAAGGTGG - Intronic
1120207185 14:81599501-81599523 GAAAAACTCCCTATTAAAGGAGG - Intergenic
1121275530 14:92664982-92665004 GAGATATTCCAAATTAAAGGAGG - Intronic
1123810031 15:23915529-23915551 GAAACATTTCCTAATACAAGAGG + Intergenic
1123837465 15:24210814-24210836 CAAACATTACATCTTAAAGCTGG + Intergenic
1123865686 15:24517619-24517641 CAAACATTACATCTTAAAGCTGG + Intergenic
1123878616 15:24652099-24652121 AAAACATTTCTCAATAAAGGAGG + Intergenic
1123883173 15:24694778-24694800 GAAACATTGCTTTATAAAGGAGG + Intergenic
1123892195 15:24793010-24793032 GAAACATTTTTTAATAAAAGAGG + Intergenic
1123895749 15:24828244-24828266 GAAACATTTCTTAATAAAACAGG + Intronic
1124419949 15:29512351-29512373 GAAACATTTCAGCTTAAGTGAGG + Intronic
1125644271 15:41258500-41258522 GAAATGTTCCAGATTAAAGGAGG - Intronic
1126168884 15:45677534-45677556 GAAACATCACAGATTAAAGGAGG - Intronic
1127201112 15:56652190-56652212 GAAACACGTCATATAATAGGTGG + Intronic
1128935449 15:71742504-71742526 GAAATATGTCATGTTGAAGGGGG - Intronic
1130747253 15:86668542-86668564 GAAATATTGCAGATAAAAGGGGG - Intronic
1131591442 15:93753379-93753401 GAAAAATTTCTTATTATAGCTGG + Intergenic
1131592389 15:93763770-93763792 GAAAAATGTCATATTACAGCCGG + Intergenic
1131858588 15:96626817-96626839 GAAACATTTAAAAATAAAGGGGG + Intergenic
1131919961 15:97315073-97315095 GTAACTTTTTATTTTAAAGGAGG - Intergenic
1132917641 16:2361179-2361201 GAAGGATTTCATCTTAAAGTTGG + Intergenic
1133135362 16:3707479-3707501 GAAACATTTCCTCTTAAGGCCGG - Intronic
1136990640 16:35149327-35149349 GAAACATTTCATGTTCTGGGAGG - Intergenic
1137237924 16:46630375-46630397 AAAACATCTCATAGTAAAGTTGG - Intergenic
1137315505 16:47316655-47316677 GAAACATTCCAAATGAAAGGAGG - Intronic
1140190841 16:72814758-72814780 GCAGCATTTCATGTTAAAGCAGG - Intronic
1140211110 16:72971121-72971143 GAAAAATTTCATACTAAATTAGG - Intronic
1140819260 16:78647941-78647963 CAAAAATTTCATATGAACGGTGG + Intronic
1141085283 16:81089964-81089986 GAAACATGTCCTATTCAAGAAGG - Intronic
1143194882 17:5068429-5068451 GAAAGATTTCATCATAAAGAAGG + Intergenic
1144306756 17:13975402-13975424 AAAACATCTCATGGTAAAGGAGG - Intergenic
1145372839 17:22321812-22321834 AAAAGATTTTAAATTAAAGGGGG - Intergenic
1146090625 17:29873982-29874004 GAAAGATATTTTATTAAAGGGGG + Intronic
1146154616 17:30511037-30511059 TAAAAATTTCATCTTTAAGGAGG - Intronic
1146703725 17:34984252-34984274 GAAATATTTCAGATTAAAGGAGG - Intronic
1146984053 17:37196366-37196388 AAAACATTTCATTTTAAAGTGGG + Intronic
1147021288 17:37535847-37535869 GGAGCATGTTATATTAAAGGAGG - Intronic
1150837460 17:68577293-68577315 GAAACATGAAATATTAAAGCTGG + Intronic
1151083060 17:71350557-71350579 GAAACATTTTATTCTATAGGAGG - Intergenic
1155644148 18:28057121-28057143 TAAATATTTCATCTTCAAGGAGG + Intronic
1155758078 18:29527119-29527141 CAAACTTTAGATATTAAAGGAGG - Intergenic
1156167814 18:34444262-34444284 GACTCATTTCATAGTGAAGGAGG - Intergenic
1156223574 18:35079417-35079439 TCAACTTTTCATATTAAAGAAGG - Intronic
1158742473 18:60159258-60159280 GAAACATTACATATTGCAGGTGG - Intergenic
1158944265 18:62434845-62434867 GCTACATTGCATATTAAATGTGG - Intergenic
1159954743 18:74511331-74511353 GAAACACTTCCTTTTGAAGGTGG + Intronic
1162221542 19:9181416-9181438 GAAATGTTCCAGATTAAAGGAGG - Intergenic
1162240188 19:9345846-9345868 AAAACATTTCATTTTAACAGAGG + Intronic
1163833163 19:19557434-19557456 GAATCTATTCATATTAAAAGTGG - Intergenic
1164655438 19:29917783-29917805 GAAACTTTACATATAACAGGAGG + Intergenic
1166281294 19:41795961-41795983 GAAATATATAATAATAAAGGTGG + Intergenic
926306315 2:11639748-11639770 GAAACATTTCATCTAAAGGGAGG + Intronic
926428292 2:12759853-12759875 GAAGCAATTCATATTTAAGAAGG + Intergenic
927656451 2:24951023-24951045 CAAACATTTCATTTTATAGGTGG - Intronic
927952275 2:27180050-27180072 GGAACATTACATATGAAAAGAGG + Intergenic
928239252 2:29572335-29572357 GAAACGTTTCATTTAAACGGTGG - Intronic
928345861 2:30495366-30495388 GAAATATTTATTATGAAAGGGGG - Intronic
928581819 2:32715663-32715685 GAAACATTTCTCTTTAAAGTTGG + Intronic
928680957 2:33701602-33701624 CAAAAATTTCATAATACAGGCGG + Intergenic
929178287 2:39004103-39004125 GATACAATACATATTAAAGAAGG + Intronic
930555437 2:52889366-52889388 GAAACATGGCATATCAAAGTGGG + Intergenic
931067880 2:58607402-58607424 AAAGCATTTCATATTGAAGAAGG + Intergenic
931317494 2:61146531-61146553 GAAACATATAATATTAAAAAAGG + Intronic
931494514 2:62787887-62787909 GAACCATTTTATATTAAAATTGG - Intronic
932402787 2:71493340-71493362 GAAACGTTCCAGATTAAAGGAGG - Intronic
932565178 2:72901696-72901718 GAGAAGTTTCATGTTAAAGGAGG + Intergenic
932736985 2:74261131-74261153 GAACCAGGTCATATTCAAGGTGG - Intronic
933304138 2:80576681-80576703 AAAACAATACATATTAAAGAAGG - Intronic
934081742 2:88474373-88474395 AAAAGATTTTATATAAAAGGGGG + Intergenic
934324934 2:92004350-92004372 GAAACATTTTATAATACAGAGGG - Intergenic
934463314 2:94235059-94235081 GAAACATTTTATAATACAGAGGG - Intergenic
935012438 2:99148078-99148100 GAACTGTTTCAGATTAAAGGAGG - Intronic
935522071 2:104119689-104119711 TAAACATTTCAAATTCAATGAGG + Intergenic
937422656 2:121771441-121771463 GAAACATATCACATTTAATGGGG + Intergenic
938276996 2:130035927-130035949 TAATCATTTCAAATTAAAGTGGG - Intergenic
938327964 2:130426698-130426720 TAATCATTTCAAATTAAAGTGGG - Intergenic
938361982 2:130694780-130694802 TAATCATTTCAAATTAAAGTGGG + Intergenic
938438390 2:131301465-131301487 TAATCATTTCAAATTAAAGTGGG + Intronic
940665903 2:156609468-156609490 GAAACTTTTCATAATAAGGCTGG - Intronic
940903966 2:159152066-159152088 TGAACATTTCATATAAATGGTGG + Intronic
941700364 2:168597665-168597687 AAAACTTTACATATTCAAGGTGG - Intronic
943334358 2:186595875-186595897 TAAACATTTCTTATCAATGGTGG - Intronic
943348121 2:186764869-186764891 GAAACATTTTTATTTAAAGGTGG - Exonic
943405718 2:187481575-187481597 GAGACATTTGATATTAAGGATGG - Intronic
944575666 2:201088892-201088914 GAGACATTTCATAATAATGAAGG + Intergenic
944785354 2:203064689-203064711 GAAATGTTTCAGATTAAAAGAGG + Intronic
944874612 2:203949660-203949682 AGAAGATTTTATATTAAAGGTGG + Intronic
948162756 2:235838384-235838406 GTAACATTTCATATGGTAGGAGG + Intronic
1171088342 20:22260497-22260519 GAAGCATTTCATATTAATAACGG - Intergenic
1171880514 20:30614877-30614899 GAAACACGTCATATTCTAGGAGG - Intergenic
1171939827 20:31315911-31315933 GACACATTTGAGAATAAAGGGGG + Intergenic
1173065388 20:39705855-39705877 GAAACATTTCATACACATGGAGG - Intergenic
1173148002 20:40542021-40542043 GAAATATTTTAGCTTAAAGGAGG - Intergenic
1175009606 20:55721877-55721899 GACACATTTAAGATGAAAGGAGG - Intergenic
1175530563 20:59671971-59671993 GCCACATTTCAGAATAAAGGAGG - Intronic
1176594362 21:8678110-8678132 GAAACATTTTATAATACAGAGGG - Intergenic
1176962841 21:15179045-15179067 GAAATATATCAGATTAAAGTTGG - Intergenic
1176980233 21:15373477-15373499 GAAACATTTGAAATTGAAGAAGG - Intergenic
1177091819 21:16778942-16778964 GAAATATTTCATATTGATGGAGG + Intergenic
1178080593 21:29059862-29059884 GTCATATGTCATATTAAAGGTGG - Intronic
1179216259 21:39369612-39369634 GAAATGTTTCAGATTAAAGGAGG + Intergenic
1180277215 22:10655244-10655266 GAAACATTTTATAATACAGAGGG - Intergenic
1180567366 22:16684147-16684169 GCAACTTTTCATATAAAAGGGGG + Intergenic
1180584438 22:16874132-16874154 GAAACATTTTATAATACAGAGGG - Intergenic
949586683 3:5447084-5447106 GAAAAATTTGAAAGTAAAGGAGG + Intergenic
949772531 3:7594663-7594685 GAAGCATTTCAGATCAAAGCAGG + Intronic
949974863 3:9446877-9446899 AAAATATTTCATTTTAAATGTGG - Intronic
950616247 3:14160998-14161020 GATAGATTTCTTACTAAAGGTGG - Intronic
951119879 3:18914236-18914258 ATAACTTTTCATATTAAAGTAGG - Intergenic
953061537 3:39432217-39432239 GACACCTTTCATTTTAAAGAAGG + Intergenic
954918568 3:54169796-54169818 GAAACATTTCCTATATAAGGTGG + Intronic
955815788 3:62841417-62841439 AAAGTATTTCATATTAAAGCTGG + Intronic
956214816 3:66838079-66838101 GTAACATTTTATTTTAAATGAGG - Intergenic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
956570972 3:70694576-70694598 GAAGCAATTCATGTTAAAAGTGG + Intergenic
956571114 3:70696307-70696329 GAAGCATCTCATGTTAAAAGTGG - Intergenic
957228631 3:77481823-77481845 GAACCATATCATATAAATGGTGG + Intronic
957745004 3:84329142-84329164 ATAACATTTTATATTAAAAGTGG - Intergenic
960353012 3:116616687-116616709 GAAATATTTCAGAATCAAGGAGG + Intronic
961957365 3:130817976-130817998 GAAACTTTACATATAACAGGAGG - Intergenic
963749854 3:149165390-149165412 AAAATATTTGCTATTAAAGGAGG + Intronic
964465760 3:156990077-156990099 GAAATATTCTAGATTAAAGGAGG - Intronic
964577596 3:158191635-158191657 GAAACATTTGATAAAAAATGTGG - Intronic
964950002 3:162278917-162278939 GAAACATGTAATATAAAAGGTGG - Intergenic
965193959 3:165570197-165570219 AAAACATTTAGTATTAAAGGAGG + Intergenic
965357075 3:167689084-167689106 GAAACATTACATATTCAAGTAGG + Intronic
965449061 3:168814845-168814867 GAAACCTTTCATAAGAAATGGGG - Intergenic
966659643 3:182400099-182400121 CAAAGATTGCATATTAGAGGAGG - Intergenic
967008925 3:185413181-185413203 CAAACCTGTCATATTAAAGAAGG + Intronic
967656341 3:192054640-192054662 GAAACATTTTATAATAAAGCTGG + Intergenic
971412446 4:26388647-26388669 GAAAAGTTTAATATTTAAGGTGG + Intronic
974142844 4:57909625-57909647 TAAATATTTCATATTACATGAGG - Intergenic
974337921 4:60575607-60575629 GAAATATTTCATACAAAAGATGG - Intergenic
974771444 4:66419364-66419386 AAAACAATTCATAATTAAGGAGG + Intergenic
974944229 4:68506732-68506754 TGAACATGTCATATTAAATGTGG - Intergenic
974954777 4:68624044-68624066 TGAACATGTCATATTAAATGTGG - Intronic
976434690 4:85003509-85003531 AACAAATTTCAAATTAAAGGAGG + Intergenic
977434579 4:96977356-96977378 GAATCATTTCAAATTCATGGTGG + Intergenic
977484741 4:97628276-97628298 GTAACATCTCCTTTTAAAGGTGG + Intronic
978367129 4:107994180-107994202 GAAAGTTTGCATCTTAAAGGGGG + Intronic
978658380 4:111094274-111094296 GAGACATTTCATGTTTATGGAGG + Intergenic
979389347 4:120109316-120109338 GAATCATACCATATCAAAGGAGG + Intergenic
979707865 4:123742546-123742568 GAAAAATTTCAATTTAAAGATGG + Intergenic
979722063 4:123911959-123911981 GAAACATTTAAAATTAAGTGCGG - Intergenic
979831278 4:125307509-125307531 GAAATTTTTCCTATTAAAGCTGG + Intergenic
980640138 4:135566376-135566398 GAAACTTTTCATCTTTATGGAGG - Intergenic
981693958 4:147540738-147540760 GAAACATTTCTCTCTAAAGGAGG - Intronic
982901426 4:161008774-161008796 GAAACAGATCATATCAAAGGAGG + Intergenic
983591773 4:169420972-169420994 CAAACATTTTATATTTAAAGTGG - Intronic
984179703 4:176467071-176467093 GGAGCATTTGTTATTAAAGGAGG - Intergenic
984273916 4:177584259-177584281 GAAACATTTACTATTAAAGAAGG - Intergenic
984691409 4:182730749-182730771 AAAATATTTCATATAAAAGTTGG + Intronic
985901751 5:2801334-2801356 GAGACATTTCACATTCAAGATGG + Intergenic
986552768 5:8977252-8977274 AAATCATTTCATATTAGAAGGGG + Intergenic
988296647 5:29371649-29371671 GACACATTCCATACAAAAGGAGG + Intergenic
990198680 5:53346999-53347021 TAAATATTGCATTTTAAAGGAGG + Intergenic
990682998 5:58266782-58266804 GAAACATCTCCTATTTAAGGAGG - Intergenic
990809243 5:59703591-59703613 GAAACATTTCATTGTGAAGTCGG - Intronic
992278596 5:75148743-75148765 CAAACATTTTATATTAAAATTGG + Intronic
992402860 5:76427574-76427596 GAAACGTTCCATTTTAAATGAGG + Intronic
992427899 5:76677205-76677227 GAAATATTTCCTAATAAAGGGGG - Exonic
994549355 5:101210780-101210802 GAAACAAGTCACATCAAAGGCGG + Intergenic
995136166 5:108682434-108682456 GAAGCATTTCATATTAAAAAAGG - Intergenic
995422532 5:111983231-111983253 GAAGCAATTCATATAAATGGTGG + Intronic
995813595 5:116139500-116139522 AAATCTTTTCATCTTAAAGGTGG + Intronic
998276313 5:140757328-140757350 GAACCATTTCAGATTAAATAGGG - Intergenic
1000167338 5:158665550-158665572 GAAATATATCATAATAAAGCAGG + Intergenic
1000703159 5:164478074-164478096 GAAACATGTAATATTTTAGGAGG + Intergenic
1000763012 5:165250147-165250169 GAAACATTTCATAGTAAATTGGG + Intergenic
1003393513 6:5733373-5733395 GAATCATTTCAAATTACAGCAGG + Intronic
1003689060 6:8334415-8334437 GAAACATTTACAATTAAAAGTGG - Intergenic
1006696660 6:35936666-35936688 GAAACATTTAAAATCAGAGGTGG - Intergenic
1007529651 6:42530431-42530453 GAAACATTGCTTATGAAATGAGG + Intergenic
1008895632 6:56551528-56551550 GAAACATTTGATAAAAATGGTGG - Intronic
1010424312 6:75709492-75709514 GAAACATTACATAATAAAAAAGG - Intronic
1010907117 6:81504164-81504186 GAAACATTATTTATAAAAGGTGG + Intronic
1010966807 6:82219779-82219801 GAAATATTTCATATATAATGTGG + Intronic
1012619770 6:101328575-101328597 GAAATATTTCATAATAACTGAGG + Intergenic
1013631487 6:111990235-111990257 TACATATTTCATTTTAAAGGTGG + Intergenic
1013840373 6:114384982-114385004 TAAACATTTAATATTTAATGTGG + Intergenic
1014385841 6:120801014-120801036 GAAACAACTCATATTGAAGGAGG - Intergenic
1014981520 6:127951332-127951354 GAATTGTTTCATATTAAAAGAGG - Intergenic
1015396608 6:132741719-132741741 GAAATAGATCATATCAAAGGGGG + Intergenic
1015425504 6:133061195-133061217 AAAACATTCTATATTAAATGTGG + Intergenic
1015548936 6:134392149-134392171 AAAACCTTTCAAATTGAAGGGGG - Intergenic
1016132421 6:140492164-140492186 TAAACACTTCATATTTAATGTGG + Intergenic
1017287905 6:152698967-152698989 GGAAATTTTTATATTAAAGGAGG + Intronic
1017959962 6:159213078-159213100 GAAACATTCCATAAAATAGGGGG + Intronic
1018319866 6:162596642-162596664 CACACATTTTATATTAATGGTGG + Intronic
1020705342 7:11537201-11537223 GAAACATATCTTATTACAGAAGG + Intronic
1020774663 7:12437906-12437928 GAAATATTTCAAAATAATGGAGG + Intergenic
1021251959 7:18340323-18340345 TAAACATTCCAATTTAAAGGTGG - Intronic
1022018825 7:26378297-26378319 GACAGATTTCATATTAGAGCTGG + Intergenic
1022493164 7:30836277-30836299 GACACATTTCTTACAAAAGGTGG - Intronic
1028096791 7:86770672-86770694 AAAACATTTGAATTTAAAGGAGG - Intronic
1030573240 7:111253176-111253198 GAAATATTTAATTTTAATGGAGG - Intronic
1030667162 7:112292041-112292063 GAAACACTTCCTATTTGAGGAGG + Intronic
1030671578 7:112344032-112344054 AAACTATTTCAGATTAAAGGTGG + Intergenic
1030932793 7:115545907-115545929 AAACCATTTCATATTATAGTTGG + Intergenic
1032812706 7:135437781-135437803 AAAACATTTTATATTACATGTGG - Intronic
1036394192 8:8352977-8352999 GGATCATTTAATAATAAAGGGGG + Intronic
1037097502 8:15003082-15003104 GCAAAATTTAATATTAAAAGAGG + Intronic
1038130821 8:24729235-24729257 GAAACATTTTATATTCACGATGG - Intergenic
1038922324 8:32098600-32098622 GAAACATTTTACACTAAAAGTGG - Intronic
1039341438 8:36654538-36654560 GAAACATTTTATGTTGAAAGAGG + Intergenic
1041222117 8:55662415-55662437 AAAAGATTTCATATTGATGGCGG + Intergenic
1041989410 8:63968006-63968028 GAAAGCTTTCATTTTAAATGTGG + Intergenic
1042209910 8:66369695-66369717 GAGACATTTCATAGAGAAGGAGG + Intergenic
1042491008 8:69397605-69397627 GAAACAATTCTTAGTAAAGAAGG - Intergenic
1044707430 8:95022475-95022497 GAAGCATCTCAAATCAAAGGAGG + Intronic
1044839117 8:96323070-96323092 GAAACATTACATCTTAAAGCTGG + Intronic
1046734233 8:117759220-117759242 GAAATGTTTCAGATAAAAGGAGG + Intergenic
1047355655 8:124119299-124119321 GAAAGACTTCATAGAAAAGGTGG + Intronic
1048699480 8:137072001-137072023 AAGACTTTTCATATTAAAGCAGG - Intergenic
1050283703 9:4079058-4079080 AAGATATTTCATACTAAAGGAGG + Intronic
1050747670 9:8895839-8895861 TATACATTTCACATTAAAGTTGG + Intronic
1051050294 9:12924355-12924377 GAAATATTTCATATTAATTAAGG - Intergenic
1051263234 9:15286273-15286295 AAAATGTTTCAGATTAAAGGAGG - Intronic
1051470080 9:17428756-17428778 GAAACATTGCATAGTAAAGAAGG - Intronic
1053208000 9:36204267-36204289 CAGACATTTCACACTAAAGGAGG - Intronic
1053693382 9:40611703-40611725 GAAACATTTTATAATACAGAGGG - Intergenic
1053940367 9:43242095-43242117 GAAACATTTTATAATACAGAGGG - Intergenic
1054271449 9:63028384-63028406 GAAACATTTTATAATACAGAGGG + Intergenic
1054304625 9:63410931-63410953 GAAACATTTTATAATACAGAGGG - Intergenic
1054403372 9:64734950-64734972 GAAACATTTTATAATACAGAGGG - Intergenic
1054436994 9:65220438-65220460 GAAACATTTTATAATACAGAGGG - Intergenic
1054493403 9:65801554-65801576 GAAACATTTTATAATACAGAGGG + Intergenic
1055185460 9:73447296-73447318 GAAACATTTCAAAATAAAAAAGG - Intergenic
1055212874 9:73818905-73818927 AAAACCTTTCATATTCAAGTTGG - Intergenic
1055440189 9:76329477-76329499 GAAACATTTCATATTAAAGGAGG - Intronic
1055730386 9:79274501-79274523 GAAACATTTCCTAATTAAGTTGG - Intergenic
1056179467 9:84067787-84067809 GAAAATTTTCATTTTAAAGTAGG + Intergenic
1058087216 9:100761431-100761453 GAAACATTTCACATTAAACTGGG + Intergenic
1058564404 9:106266405-106266427 GAAGAATTTCATATACAAGGAGG + Intergenic
1059016354 9:110520378-110520400 GAAACATCGCATATTAAAAAGGG - Intronic
1061392103 9:130322832-130322854 GAGACATTTCAAATTAAATTTGG + Intronic
1187552536 X:20320498-20320520 GAAATGTTCCAGATTAAAGGAGG - Intergenic
1187705757 X:22007806-22007828 AAAAGATTCCAGATTAAAGGAGG + Intergenic
1189009601 X:37034003-37034025 GAACTAGTCCATATTAAAGGAGG - Intergenic
1190167298 X:48083716-48083738 GGAAGAATTCAGATTAAAGGTGG + Intergenic
1190386182 X:49884224-49884246 GAAATGTTCCAGATTAAAGGAGG - Intergenic
1191976586 X:66878505-66878527 GACACATTTCACATTGAAAGGGG - Intergenic
1192512948 X:71736368-71736390 GAAATATTTCCTAGTTAAGGGGG + Intergenic
1192513749 X:71745141-71745163 GAAATATTTCCTAGTTAAGGGGG - Intergenic
1194390110 X:93306972-93306994 GAAACATCTCTTAATAAAGTGGG + Intergenic
1195305485 X:103578453-103578475 GAAACATCACATACTATAGGTGG - Intronic
1195472756 X:105250948-105250970 GTAACATTTCATTTTAATGTAGG + Intronic
1195524576 X:105871929-105871951 CAAACATTGCATGTTAATGGGGG - Intronic
1195600016 X:106735841-106735863 GAAAGATTCCATATTAAAATAGG - Intronic
1196396451 X:115267656-115267678 TCAACATTTCCTTTTAAAGGAGG - Intergenic
1198830899 X:140749238-140749260 GTAACATTTCATATGTGAGGCGG + Intergenic