ID: 1055440509

View in Genome Browser
Species Human (GRCh38)
Location 9:76331870-76331892
Sequence AGAGCCCTGTGGATCTATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055440505_1055440509 1 Left 1055440505 9:76331846-76331868 CCTCCTAGAGCCTCTAAAAGGAA 0: 1
1: 2
2: 15
3: 77
4: 293
Right 1055440509 9:76331870-76331892 AGAGCCCTGTGGATCTATTTTGG No data
1055440506_1055440509 -2 Left 1055440506 9:76331849-76331871 CCTAGAGCCTCTAAAAGGAACAG 0: 1
1: 0
2: 21
3: 166
4: 600
Right 1055440509 9:76331870-76331892 AGAGCCCTGTGGATCTATTTTGG No data
1055440507_1055440509 -9 Left 1055440507 9:76331856-76331878 CCTCTAAAAGGAACAGAGCCCTG 0: 1
1: 0
2: 22
3: 131
4: 505
Right 1055440509 9:76331870-76331892 AGAGCCCTGTGGATCTATTTTGG No data
1055440504_1055440509 2 Left 1055440504 9:76331845-76331867 CCCTCCTAGAGCCTCTAAAAGGA 0: 1
1: 0
2: 4
3: 36
4: 225
Right 1055440509 9:76331870-76331892 AGAGCCCTGTGGATCTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055440509 Original CRISPR AGAGCCCTGTGGATCTATTT TGG Intronic
No off target data available for this crispr