ID: 1055441252

View in Genome Browser
Species Human (GRCh38)
Location 9:76338648-76338670
Sequence CTCTGGGCCTTGAAGGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 523
Summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 471}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055441252_1055441260 -2 Left 1055441252 9:76338648-76338670 CCCCCATCCTTCAAGGCCCAGAG 0: 1
1: 0
2: 2
3: 49
4: 471
Right 1055441260 9:76338669-76338691 AGACAGGCATCATCTCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055441252 Original CRISPR CTCTGGGCCTTGAAGGATGG GGG (reversed) Intronic
900415332 1:2532072-2532094 CTCTGGCCCTTGATGGATGCAGG + Intergenic
900806795 1:4772814-4772836 CTCTGGGGCACGAAGGATGACGG - Intronic
900897988 1:5497237-5497259 TTGTGGCCCTTGAAGGATGAGGG - Intergenic
900906380 1:5562600-5562622 TTCTGGGGTCTGAAGGATGGTGG + Intergenic
900967635 1:5970046-5970068 CCCTGGGCCTGGCAGGAAGGCGG - Intronic
902389928 1:16097417-16097439 CTCTGGAGCTTGAGGGAGGGAGG + Intergenic
903514299 1:23900282-23900304 CTCTGATCCTTGAATGCTGGTGG + Intronic
904418385 1:30376262-30376284 CTCATGGCCTTGAAGGGTGGGGG - Intergenic
904971839 1:34425415-34425437 CTCTGGGCCCTGCAGTTTGGTGG - Intergenic
905502652 1:38451889-38451911 CTCTCAGCCTGAAAGGATGGAGG - Intergenic
906481937 1:46204709-46204731 CACTTGGCCTTGAAGGTTGGAGG + Intronic
907786843 1:57620791-57620813 CTCTGGGTCTGGAAGCAGGGGGG + Intronic
908024657 1:59938145-59938167 CTCTGGACATTGAATGAAGGGGG + Intergenic
908389108 1:63669469-63669491 CTGGGGGCATTGAAGGAGGGCGG - Intergenic
909237582 1:73173434-73173456 CTCAGAGCCTTAAAGGATGCAGG - Intergenic
909532052 1:76692587-76692609 CTCTGGGGGCTGAAGGATGGTGG + Intergenic
909881082 1:80879651-80879673 CTATGGGGGTTGAGGGATGGAGG - Intergenic
910055868 1:83032432-83032454 TTCTGGGTTCTGAAGGATGGTGG - Intergenic
910083540 1:83371607-83371629 CTCTGGGGTCTGGAGGATGGTGG + Intergenic
911515754 1:98866379-98866401 TTCTGGGCTGTGGAGGATGGAGG + Intergenic
911721602 1:101197133-101197155 AGCTGGACCTTGGAGGATGGCGG - Intergenic
911893501 1:103401576-103401598 TTCTGGGCTCTGGAGGATGGTGG + Intergenic
912729643 1:112090853-112090875 CTCTGGGCCATTAAGGATTTGGG - Intergenic
914166715 1:145182192-145182214 GTCTTGGCCTTGCAGGAGGGGGG + Intergenic
915364774 1:155308981-155309003 TGCTGGGCCTTGGAGGAAGGGGG + Exonic
915442035 1:155951332-155951354 ATCTGGGCCTTGGAGGGTGAAGG - Intronic
915448877 1:155990793-155990815 GTCTAGGCCTGGAAGGAAGGAGG + Intronic
915940961 1:160117901-160117923 CTCTGGGTCTTGAATGCTGAAGG - Intronic
916556184 1:165896175-165896197 CTCTGTGCTTTGCAGGAAGGAGG + Exonic
916814397 1:168337568-168337590 TTCTGGGGCGTGAAGGATGGTGG + Intergenic
917082674 1:171272440-171272462 TTCTGGGGTCTGAAGGATGGTGG - Intronic
917290878 1:173471205-173471227 CTCTGGGGTCTGGAGGATGGTGG - Intergenic
917577356 1:176337972-176337994 TTCTGGGTTTTGAAGGATTGAGG + Intergenic
918800204 1:188961238-188961260 TTCTGGGGCCTGGAGGATGGTGG - Intergenic
919473761 1:198010103-198010125 TTCTGGGGTCTGAAGGATGGTGG + Intergenic
920370078 1:205473239-205473261 CACATGGCCTTGGAGGATGGTGG - Intergenic
920565932 1:206973353-206973375 CTCTGGTCCTTGCAGGATGGAGG + Intergenic
920872607 1:209806421-209806443 TTATGGGCCGTGAAGGAGGGAGG - Intergenic
922233312 1:223704727-223704749 CCCTGTGCCTGGAAGGAGGGAGG + Intronic
922585045 1:226727722-226727744 CTCAGGGCGTTGAGGGGTGGGGG - Intronic
924804743 1:247353264-247353286 TTCTGGGGCTTGAGGGATTGTGG + Intergenic
924907380 1:248470537-248470559 CTCTGAGCCTTTAAGGAGAGGGG + Intergenic
924916735 1:248577573-248577595 CTCTGAGCCTTTAAGGAGAGGGG - Intergenic
1064097488 10:12434809-12434831 TTCTGAGACTTGAAGGATGTGGG + Intronic
1064742886 10:18451129-18451151 AGCTGGGATTTGAAGGATGGTGG + Intronic
1065516921 10:26532995-26533017 CTCAAGGCCTTGTAGGCTGGCGG - Intronic
1066695831 10:38076831-38076853 TTCTGGGGTCTGAAGGATGGTGG + Intergenic
1067478462 10:46580920-46580942 ATCTCGGCCTTGAAGGGTTGGGG - Exonic
1067616275 10:47760881-47760903 ATCTCGGCCTTGAAGGGTTGGGG + Intergenic
1067925822 10:50507052-50507074 CTCTGGGCCTATAAGCCTGGGGG - Intronic
1068388479 10:56361230-56361252 CTCGGCGCCTGGAAAGATGGAGG - Exonic
1068449308 10:57165434-57165456 TTCTGGGGTGTGAAGGATGGTGG + Intergenic
1069137830 10:64785997-64786019 CTCTGGGGCTTCAGGGATTGTGG + Intergenic
1069675314 10:70242426-70242448 GTCAGGGCCTGGAAGGAAGGAGG + Intergenic
1069716894 10:70526837-70526859 CTCTGGGTCTTCCAGGATGCAGG + Intronic
1069722244 10:70557232-70557254 CTGTGTGCTTTGAGGGATGGTGG + Intronic
1069723546 10:70563941-70563963 CTCTGATCCTTGGAGGATTGGGG + Intronic
1069731960 10:70622840-70622862 CTCTGAGCTTGGAGGGATGGAGG - Intergenic
1069928298 10:71866151-71866173 CTCTGGCCCTGGAAGGAGTGAGG + Intergenic
1071464021 10:85923276-85923298 CTCAGGTCACTGAAGGATGGTGG + Intronic
1073396647 10:103223558-103223580 TTCTGGGGTCTGAAGGATGGTGG + Intergenic
1073517580 10:104091079-104091101 AGCTGGGCCTTAAAGGATCGGGG + Intergenic
1074022349 10:109596985-109597007 TTCTGGGGTCTGAAGGATGGTGG + Intergenic
1075426034 10:122342330-122342352 ACCTGGGCCTGGAAGGATGGGGG + Intergenic
1075826109 10:125358267-125358289 TTCTGGAGTTTGAAGGATGGTGG + Intergenic
1076022374 10:127084751-127084773 CTCTGTGCCTTGGTGGGTGGAGG - Intronic
1076102528 10:127794467-127794489 CACATGGACTTGAAGGATGGTGG - Intergenic
1076581892 10:131517375-131517397 CTCTGGGGCTGGATGGATGAGGG + Intergenic
1076726612 10:132416893-132416915 CTGTGGGCCCTGAGGGAAGGAGG + Intronic
1077025742 11:439158-439180 CTGTGGGACAGGAAGGATGGGGG - Intronic
1077647034 11:3934390-3934412 AACTGGGCCTTCAAGGATGAGGG - Intronic
1078365062 11:10699742-10699764 TTCTGGGGTCTGAAGGATGGAGG - Intergenic
1079077523 11:17393352-17393374 CTCTGAGCCTTGAAGCCTGGAGG - Intronic
1079331829 11:19540085-19540107 GTCTGGCCCTTCAGGGATGGTGG - Intronic
1079511528 11:21216397-21216419 TTCTGGGATCTGAAGGATGGTGG - Intronic
1080430001 11:32189375-32189397 GACTGGGCCTTGAAGGGTTGGGG - Intergenic
1081002838 11:37695855-37695877 CTCTGGGGTCTGGAGGATGGTGG - Intergenic
1081712210 11:45224627-45224649 CTGTCGGCCTTGAATGATGAAGG - Exonic
1083110329 11:60400082-60400104 CTCTGGGCCTTGAAGAGAAGAGG - Intronic
1083912945 11:65720588-65720610 CTCGGGGCCCTGGCGGATGGCGG + Exonic
1084214261 11:67639085-67639107 CTCTGGGCCCTGAGGAATGCTGG - Intronic
1084419902 11:69055118-69055140 CTCTGGGCCCTGAGGGCTGCTGG + Intronic
1084900511 11:72306613-72306635 CTCTGAGCCATGGAGGAAGGGGG + Intronic
1084955874 11:72691325-72691347 CCCTGGGCATGGAAGGAAGGAGG - Intronic
1085017293 11:73183145-73183167 AGCTGGGCTTTGAAGGATGGAGG - Intergenic
1085516636 11:77115673-77115695 GGCTGGGCCTTGAAGGATCTGGG + Intronic
1086309779 11:85522485-85522507 TTCTGGGGCCTGGAGGATGGTGG - Intronic
1086969500 11:93065629-93065651 TTCTGGGGTCTGAAGGATGGTGG + Intergenic
1087467363 11:98525764-98525786 CTCTGGGGCTCCAAGGGTGGTGG - Intergenic
1088381893 11:109201904-109201926 CTCTGGGCCTTGGAGGGAGTGGG - Intergenic
1088853073 11:113721426-113721448 ACCTGGGTCTTAAAGGATGGTGG - Intergenic
1088884257 11:113994653-113994675 GTATTGGCCTTGAAGGAAGGGGG - Intergenic
1089881853 11:121781578-121781600 CACTGGGGCTTGTAAGATGGTGG - Intergenic
1090374865 11:126281578-126281600 CTATGGCCTTTGAGGGATGGAGG + Intergenic
1091086313 11:132725038-132725060 TTCTGGGGTCTGAAGGATGGTGG + Intronic
1091329174 11:134717138-134717160 ATCTGAGCCTTGAAGGATGATGG - Intergenic
1092710365 12:11330272-11330294 CTTTGGACATTGAAGGGTGGAGG + Intergenic
1092714128 12:11370768-11370790 CTTTGGACATTGAAGGGTGGAGG + Intronic
1092717831 12:11409791-11409813 CTTTGGACATTGAAGGGTGGAGG + Intronic
1092922659 12:13246354-13246376 ATCATGGCCTTGAAGGATGCAGG - Intergenic
1092944272 12:13438688-13438710 TTCTGGGGTCTGAAGGATGGTGG + Intergenic
1093401677 12:18753860-18753882 CTCTGGGGCTTCAAGGGTCGTGG - Intergenic
1093536612 12:20230719-20230741 TTCTGGGGTCTGAAGGATGGTGG + Intergenic
1093753732 12:22829969-22829991 TTCTGGGGCCTGGAGGATGGTGG - Intergenic
1095226699 12:39686135-39686157 TTCTGGGGTCTGAAGGATGGCGG + Intronic
1096555734 12:52402553-52402575 CTCTGGCCCTTGGAGGATAATGG - Intronic
1097510228 12:60529772-60529794 TTCTGGGGGCTGAAGGATGGCGG - Intergenic
1097678637 12:62628643-62628665 CACTGGGTCATGAAGGATGAAGG - Intergenic
1099119635 12:78672210-78672232 CCCTGGGCCTTCTAGGATGCAGG - Intergenic
1099407481 12:82281889-82281911 TTCTGGGATCTGAAGGATGGTGG - Intronic
1099526802 12:83726626-83726648 TTCTGGGGTCTGAAGGATGGTGG - Intergenic
1099846133 12:88030963-88030985 TTCTGGGGTTTGGAGGATGGTGG + Intronic
1100123451 12:91395416-91395438 TTCTGGGGCCTGGAGGATGGTGG - Intergenic
1101663528 12:106788365-106788387 TTCTGGGGTTTGGAGGATGGTGG + Intronic
1102510865 12:113414552-113414574 CTCAGGGGCTTGAAGCAGGGTGG - Intronic
1103197334 12:119056117-119056139 TTCTGGGCCTTGTGGGAGGGAGG - Intronic
1103254436 12:119528823-119528845 CTCTATGCCTTGAAGGACAGTGG - Intronic
1103277203 12:119722415-119722437 CTCTGGGCCTGCTGGGATGGAGG - Intronic
1103970147 12:124665571-124665593 ATCTGGGCCTTGAAGGTAGATGG + Intergenic
1104240496 12:126984634-126984656 TTCTGGGGTCTGAAGGATGGTGG + Intergenic
1104342826 12:127967259-127967281 TTCTGGGGCCTGGAGGATGGTGG + Intergenic
1104843710 12:131836313-131836335 CCCTGGGACTTCCAGGATGGTGG + Intronic
1105700729 13:22934488-22934510 AGCTGGTCATTGAAGGATGGTGG - Intergenic
1106533551 13:30617850-30617872 CGCTGGGCCTGAAAGGACGGTGG - Exonic
1108419513 13:50234120-50234142 TTCTGGGGTCTGAAGGATGGTGG - Intronic
1108828887 13:54452510-54452532 TTCTGGGGTCTGAAGGATGGTGG + Intergenic
1108874244 13:55025401-55025423 TTCTGGGGTCTGAAGGATGGTGG - Intergenic
1109602435 13:64649755-64649777 CTCTAGGGCTTTATGGATGGTGG + Intergenic
1109862976 13:68224770-68224792 TTCTGGGGTTTGAAGGATAGTGG + Intergenic
1110007791 13:70294071-70294093 TTCTGGGGTTTGGAGGATGGTGG - Intergenic
1111566853 13:90027975-90027997 TTCTGGGGTCTGAAGGATGGTGG - Intergenic
1111606384 13:90545451-90545473 CTCTGGGGCTTCAGGGATTGCGG - Intergenic
1112163015 13:96888917-96888939 TTCTGGGGTCTGAAGGATGGTGG + Intergenic
1113382786 13:109818765-109818787 CTCTGTGCCATGGAAGATGGCGG - Intergenic
1115245126 14:31287038-31287060 CTCTGGGGCTTCAAGGGTTGTGG - Intergenic
1115571465 14:34670667-34670689 CTTTAGGCCTGGAAGGATGATGG - Intergenic
1116213002 14:41972169-41972191 TTCTGGGTTCTGAAGGATGGTGG + Intergenic
1117084068 14:52181132-52181154 TTCTGGGGTCTGAAGGATGGTGG + Intergenic
1117590796 14:57266339-57266361 CTCTTGGCCTTGGAGGGAGGAGG - Intronic
1117752208 14:58935885-58935907 TTCTGGAATTTGAAGGATGGTGG + Intergenic
1118314445 14:64717037-64717059 CCCTGGGCCCTGTAGGATAGGGG + Intronic
1118598050 14:67451334-67451356 TTCTGGGGCCTGGAGGATGGTGG - Intronic
1120621958 14:86775516-86775538 TTCTGGGGTCTGAAGGATGGTGG - Intergenic
1121102776 14:91261490-91261512 GGCAGGGCCTTGAAGGATGGAGG + Intergenic
1121760017 14:96436790-96436812 CTCTGGGACTCCAGGGATGGTGG + Intronic
1121957318 14:98226351-98226373 TTGGGGGCCATGAAGGATGGTGG - Intergenic
1122213491 14:100188387-100188409 CTCTGGGCCTTGCTCTATGGGGG - Intergenic
1122388350 14:101364075-101364097 CTCTTGGGCATGAAGGATGATGG - Intergenic
1122645622 14:103191521-103191543 CTCTTGGCCTCGAGGGAAGGCGG + Intergenic
1122842322 14:104472501-104472523 AACTGGGCGTTGAAGGATGGTGG - Intergenic
1122874884 14:104659450-104659472 CTCTGGGCTGGGAAGGAGGGAGG - Intergenic
1123111294 14:105868157-105868179 GTCTGGGCCTAGAAGCAGGGGGG + Intergenic
1123195890 14:106616171-106616193 TTCTGGGTTCTGAAGGATGGTGG + Intergenic
1123408685 15:20040750-20040772 TTCTGGGGTCTGAAGGATGGTGG - Intergenic
1123518016 15:21047460-21047482 TTCTGGGGTCTGAAGGATGGTGG - Intergenic
1123629007 15:22247922-22247944 TTCTGGGGCCTGGAGGATGGTGG - Intergenic
1123795646 15:23767367-23767389 TTCTGGGGTTTGGAGGATGGTGG - Intergenic
1124634769 15:31357972-31357994 ATCTGGGGCTGGAAGGGTGGTGG + Intronic
1124657916 15:31523730-31523752 CTCTGGGGCTTGAGGGCTGCAGG - Intronic
1125246509 15:37647202-37647224 TTCTGGGGCCTGAAGGATGGTGG - Intergenic
1126185046 15:45823570-45823592 TTCTGGGGTCTGAAGGATGGTGG + Intergenic
1127283354 15:57510921-57510943 CTCTGGGCCGTGAAAGATAGCGG - Intronic
1127625749 15:60778606-60778628 CTCGGGGCCTTGAAGGTAGGGGG + Intronic
1129241517 15:74255094-74255116 TTCTGGGGCTTTCAGGATGGGGG - Intronic
1129462510 15:75706653-75706675 AGCTGAGCCTTGGAGGATGGGGG + Intronic
1129661852 15:77557202-77557224 TGCTGGGCCATGAGGGATGGGGG + Intergenic
1129722354 15:77884761-77884783 AGCTGAGCCTTGGAGGATGGGGG - Intergenic
1129826915 15:78640532-78640554 CACTGGGCCGAGAAGGAAGGGGG - Intronic
1130131296 15:81145000-81145022 CTCTGGTCCTTGAAATAGGGAGG - Intronic
1131419340 15:92291172-92291194 ACCTGGGCCTTGAAGGACAGGGG - Intergenic
1131943213 15:97590301-97590323 CCCTGGTCTTTGAAGAATGGGGG - Intergenic
1132303767 15:100793764-100793786 TTCTGGGGTTTGAAGGACGGTGG + Intergenic
1132678906 16:1131704-1131726 CCCTAGGCCTGGAAGGAAGGTGG - Intergenic
1134357778 16:13500495-13500517 ATCTGGGTCTTGTAGGATGATGG + Intergenic
1135721291 16:24820687-24820709 ATCTGGGCCTTGAAGACTAGGGG + Intronic
1137492335 16:48943651-48943673 CTCTGGGGCTGGAAGGAGGGTGG + Intergenic
1138131577 16:54484462-54484484 GTCTGGGCTTTGAATGGTGGGGG + Intergenic
1138269208 16:55682754-55682776 ATCTGGGCTTTGAAGGGTGTTGG + Intronic
1139595430 16:67955049-67955071 CACAGGGCATTGGAGGATGGTGG - Intronic
1140197745 16:72869295-72869317 GGCTGGTCCTTGAAGGATGATGG - Intronic
1140289557 16:73640032-73640054 CTCCTGGCTTTGAGGGATGGAGG - Intergenic
1140393190 16:74606387-74606409 CTCTGGGCCTCGGCGGATTGCGG + Intronic
1141660660 16:85439388-85439410 CTCTCAGCCTTGGAGGCTGGGGG + Intergenic
1141975069 16:87510336-87510358 TTCTGGGGCCTGGAGGATGGTGG + Intergenic
1143381864 17:6501621-6501643 CTCTGGGCCTTGCAGCTTTGGGG + Intronic
1144351678 17:14402920-14402942 TTCTGGGGTCTGAAGGATGGTGG - Intergenic
1145253585 17:21310521-21310543 CTGGGGCCCTTGCAGGATGGGGG - Intronic
1145899119 17:28478524-28478546 AGTTGGGCCTTGAAGGTTGGTGG + Intronic
1146063936 17:29621069-29621091 CTCTGGTCCTTGAGGGCTTGGGG + Intronic
1148553825 17:48565998-48566020 CTCTGTGCCTTTAAGGAGGCAGG - Intronic
1149370931 17:55992898-55992920 TTCTGGGGCCTGGAGGATGGTGG + Intergenic
1149577879 17:57726942-57726964 CTCTTGGCCTTGGAGGAGGCGGG + Intergenic
1150226928 17:63529378-63529400 CTCTGGGCCTAGGAGGAGTGTGG - Intronic
1151283836 17:73095722-73095744 ACCTGGGTCTTGCAGGATGGTGG - Intergenic
1151593848 17:75064832-75064854 CTCTGAGCCGGGTAGGATGGAGG + Exonic
1151877872 17:76877544-76877566 CTCTCAGGCTTGATGGATGGGGG + Intronic
1152129461 17:78467173-78467195 CGCTGGGCCCTGAGGGATAGTGG + Intronic
1152204658 17:78968074-78968096 CTGAGGGCCGTGTAGGATGGGGG - Intergenic
1152646093 17:81469185-81469207 CTCTGGCTCTTAAAGGAGGGAGG - Intergenic
1154010273 18:10568293-10568315 CTCTCAGCCTTGCAGGAGGGAGG + Intergenic
1155216692 18:23649516-23649538 GCCTTGGCCTTGAAGGATGGAGG - Intronic
1157579456 18:48764941-48764963 CTCTGGGCCTTGGAGTCAGGGGG - Intronic
1158407233 18:57170847-57170869 CTCTGGGCTTTGTGGGATGCTGG + Intergenic
1159869028 18:73739907-73739929 CTCTGCTCATGGAAGGATGGAGG - Intergenic
1160009127 18:75090234-75090256 CTGTTGGCCTGGAAGGCTGGAGG + Intergenic
1160367106 18:78335603-78335625 CTATGGGGCTGGAAGGATGGAGG + Intergenic
1161518819 19:4712243-4712265 GTCTGGGCCTTTAAGAATGCTGG - Intronic
1161742919 19:6035217-6035239 CTCTGGGTCTTGCAGGAGGAAGG + Intronic
1162120643 19:8464866-8464888 CTGAAGGACTTGAAGGATGGGGG + Intronic
1163407110 19:17129595-17129617 CTCTTGGACTTGAGGGAGGGCGG + Intronic
1163521986 19:17796857-17796879 CTCTGGGCCTCAGAGGCTGGTGG - Intronic
1163702686 19:18794079-18794101 AGCTGGACCTTGAAGGATGGAGG - Intergenic
1163772398 19:19198939-19198961 CTCTGAACCATGGAGGATGGAGG - Intronic
1165749577 19:38251928-38251950 TTCAGGGCCTGGGAGGATGGAGG + Intronic
1165812169 19:38618141-38618163 CCCTGGGCCTTGGAGGTTGAGGG - Intronic
1166376544 19:42330700-42330722 CTATGGGCCTTGTAGGCTGCAGG + Intronic
1166541808 19:43610753-43610775 CACTGGGTCCTAAAGGATGGTGG - Intronic
1166732527 19:45067232-45067254 CCCTGGGCCTTGCAGGAAGGAGG + Intronic
1167635394 19:50651530-50651552 CTGTGTGCCTTGGAGGATGCTGG - Intronic
925001175 2:403947-403969 ATCTGGGGTTTGGAGGATGGTGG + Intergenic
925140108 2:1544264-1544286 CTCTGGGCAGTGAAGGGAGGTGG + Intergenic
925473981 2:4192458-4192480 TTCTGGGGTCTGAAGGATGGTGG + Intergenic
926747088 2:16167772-16167794 CCATGGGCCTTGAAGGATGTTGG + Intergenic
926751529 2:16202286-16202308 CTGTGGGCCTTGCAGGGTGTTGG + Intergenic
926947474 2:18203748-18203770 TTCTGGGGTTTGGAGGATGGTGG - Intronic
927302862 2:21536128-21536150 TTCTGGGATCTGAAGGATGGGGG - Intergenic
928430628 2:31215562-31215584 CCCTGAGCTTTGAAGGATGAGGG - Intronic
929446773 2:42008373-42008395 CACTGGAGGTTGAAGGATGGAGG + Intergenic
929488508 2:42375844-42375866 CTCATGCCCTTAAAGGATGGGGG - Intronic
929823124 2:45289457-45289479 CGATGGGCCTTGAAGGCTAGGGG - Intergenic
931272165 2:60712744-60712766 TTCTGGGGTCTGAAGGATGGTGG - Intergenic
931430605 2:62206012-62206034 ACCTGGGCCTTCAAGGATGGGGG + Intronic
931783070 2:65596548-65596570 CTCTGGGCCTGAGAGTATGGGGG - Intergenic
932849567 2:75171515-75171537 CTCTGGGGTCTGAAGGATGGTGG - Intronic
933046214 2:77540192-77540214 TTCTGGGGTCTGAAGGATGGTGG - Intronic
933548113 2:83740486-83740508 TTCTGGGGTCTGAAGGATGGTGG + Intergenic
933578075 2:84092624-84092646 TTCTGGGTCCTGAAGGAGGGTGG + Intergenic
933946808 2:87293929-87293951 CTTTGGGCCTTGAAGTCTGATGG - Intergenic
934118287 2:88815991-88816013 TTCTGGGGTCTGAAGGATGGTGG - Intergenic
935656413 2:105427517-105427539 CTCCGGGGCTTGGGGGATGGAGG + Intronic
936333381 2:111567626-111567648 CTTTGGGCCTTGAAGTCTGATGG + Intergenic
936738528 2:115475587-115475609 TTCTGGGGTTTAAAGGATGGTGG - Intronic
936897625 2:117446045-117446067 TTCTGGGTTTTGCAGGATGGTGG - Intergenic
936969664 2:118164972-118164994 CTCTGGGATCTGGAGGATGGTGG - Intergenic
937862213 2:126720085-126720107 CTGTGGGCCTTGAGGGAAGTGGG + Intergenic
938165407 2:129021497-129021519 TTCTGGGGTTTGGAGGATGGTGG - Intergenic
938279839 2:130056096-130056118 ATCTGGGCTCTGGAGGATGGTGG - Intergenic
938330791 2:130446811-130446833 ATCTGGGCTCTGGAGGATGGTGG - Intergenic
938492999 2:131775728-131775750 CTCTGGCCCTTGCAGGAGGTGGG + Intergenic
938499470 2:131822913-131822935 CTCTGGCTCTTGAAGGAGGTGGG - Intergenic
939578121 2:143919838-143919860 TTCTGGGGTCTGAAGGATGGTGG - Intergenic
939835601 2:147125784-147125806 CTCTGGGGTCTGGAGGATGGTGG - Intergenic
940011750 2:149061612-149061634 CCCGGGGCTTTGGAGGATGGGGG + Intronic
940143799 2:150523948-150523970 TTCTGGGGCCTGGAGGATGGTGG - Intronic
940426853 2:153540512-153540534 CTCTGGGGTCTGGAGGATGGTGG - Intergenic
940691371 2:156924348-156924370 TTCTGGGGTCTGAAGGATGGTGG - Intergenic
940774340 2:157871308-157871330 CTCTGAGCCTTGAAGAATCTGGG + Intronic
942846126 2:180428420-180428442 ATCTGGGGTCTGAAGGATGGTGG + Intergenic
943557862 2:189427523-189427545 TTCTGGGGTCTGAAGGATGGTGG - Intergenic
944470286 2:200045678-200045700 TTCTGGGGTTTGGAGGATGGTGG + Intergenic
945259349 2:207829912-207829934 CTCTGGGTCCTGAATGGTGGTGG - Intronic
946534095 2:220607750-220607772 TTCTGGGGTCTGAAGGATGGTGG + Intergenic
947236830 2:227949884-227949906 ATCTGGGGTCTGAAGGATGGTGG - Intergenic
948221046 2:236270004-236270026 TTCTGGGGTCTGAAGGATGGTGG - Intergenic
948570940 2:238916761-238916783 CTCTGGGACTAGAAGGAAGGTGG + Intergenic
1170079043 20:12450964-12450986 TTCTGGGGTTTGGAGGATGGTGG - Intergenic
1171285779 20:23937216-23937238 CACTGGGCCCTGAGAGATGGAGG + Intergenic
1172129762 20:32647890-32647912 CTCTGAGCCTGGAAGGGTGGGGG - Intergenic
1172578810 20:36030732-36030754 CTGTGGGACTTGGAGGAAGGGGG + Intergenic
1173537986 20:43830369-43830391 CACTGGGCATGGAAGGAGGGAGG - Intergenic
1174312854 20:49672507-49672529 CTCTGGGCCATGCAGAATGCTGG + Intronic
1176107587 20:63396650-63396672 CTCCAGGCCATGAAGGATGAGGG + Intergenic
1176132780 20:63503262-63503284 CTCTGGGCCCTGGAGGAAGAGGG + Intergenic
1176935332 21:14860619-14860641 TTCTGGGGTCTGAAGGATGGTGG + Intergenic
1177504271 21:22000546-22000568 TTCTGGGCTCTGGAGGATGGTGG + Intergenic
1177525753 21:22287903-22287925 TTCTGGGGTCTGAAGGATGGTGG - Intergenic
1177641072 21:23845483-23845505 TTCTGGGGTTTGGAGGATGGTGG + Intergenic
1177703878 21:24674753-24674775 CTCTGGGGCTTCAGGGTTGGTGG + Intergenic
1179432660 21:41334755-41334777 CTCTGGGGTCTGGAGGATGGTGG - Intronic
1179651004 21:42808641-42808663 CTCTCTGCCTTCAAGGATGCGGG + Intergenic
1180108088 21:45633107-45633129 CACAGGGCCTTGAAGGCTGGGGG - Intergenic
1180787058 22:18553215-18553237 CTCTGGGTCCTGCAGGAGGGGGG + Intergenic
1181234682 22:21442091-21442113 CTCTGGGTCCTGCAGGAGGGGGG - Intronic
1181243967 22:21492740-21492762 CTCTGGGTCCTGCAGGAGGGGGG + Intergenic
1182280260 22:29214340-29214362 ATCTGGGCTTTGAAGGTAGGAGG + Intronic
1182761660 22:32727145-32727167 CACTGAGCCTTGCAGGAGGGTGG - Intronic
1184311966 22:43651587-43651609 TTCTGGGGTTTGGAGGATGGTGG - Intronic
1184677397 22:46051148-46051170 CTCTGGGCCTAGGGGGAGGGCGG + Exonic
1184866540 22:47204718-47204740 CTCAGGGCCTGGAAGGATGCTGG + Intergenic
949573613 3:5317691-5317713 CTCTGAACCCTAAAGGATGGTGG - Intergenic
949770323 3:7570693-7570715 TTCTGGGGTCTGAAGGATGGTGG + Intronic
950314804 3:11991864-11991886 AGCTGGGCCTTAAATGATGGGGG + Intergenic
950360164 3:12444411-12444433 CTCTGGGAATTGAAGGTTAGGGG + Intergenic
951100666 3:18684453-18684475 TTCTGGGGCCTGAAGGATGGTGG - Intergenic
952770145 3:36992737-36992759 CTCTTGGCCTTGAAGGGTCGCGG - Exonic
952932850 3:38373551-38373573 CACTGGTCCCTGATGGATGGAGG + Intronic
952939676 3:38432905-38432927 CTCTGGGGTCTGGAGGATGGTGG + Intergenic
953778870 3:45847700-45847722 CTCTGAGCCTTGAAGGAAAAAGG - Intronic
954677943 3:52325938-52325960 CTATGAGCCTGGAGGGATGGTGG - Intronic
955015184 3:55063346-55063368 GTCTCAGCCTTGAAGGATGTTGG + Intronic
955338878 3:58109432-58109454 TGGTGGGCCTTGAATGATGGAGG + Intronic
956170678 3:66431227-66431249 CTCTGCCCCTTGAGGGAAGGAGG + Intronic
956805512 3:72806750-72806772 AATTGGGACTTGAAGGATGGAGG - Intronic
957444007 3:80291660-80291682 TTCTGGGCTGTGGAGGATGGTGG + Intergenic
957843341 3:85699286-85699308 CTCTAGGACCTGGAGGATGGCGG + Intronic
958083806 3:88780456-88780478 CTCTGGGGTCTGGAGGATGGTGG + Intergenic
958550552 3:95607069-95607091 CTCTGGGGTTTGAAGGATGGTGG + Intergenic
959051178 3:101526445-101526467 CTCTGGGGTCTGGAGGATGGTGG - Intergenic
960492416 3:118333470-118333492 TTCTGGGGTCTGAAGGATGGTGG - Intergenic
961067598 3:123889697-123889719 TTCTGGGGTCTGAAGGATGGTGG + Intergenic
961701934 3:128751234-128751256 TTCTGGGGTCTGAAGGATGGTGG - Intronic
962007166 3:131360977-131360999 CTCTGAGCTATGAAGGAGGGTGG - Intergenic
962009531 3:131380693-131380715 CTCTGAGCTATGAAGGAGGGTGG - Intergenic
964589227 3:158341716-158341738 TTCTGGGGCCTGAAGGATGGTGG - Intronic
965083441 3:164064875-164064897 TTCTGGGGTTTGGAGGATGGTGG - Intergenic
966299463 3:178462186-178462208 TTCTGGGGTCTGAAGGATGGTGG - Intronic
967480686 3:189969608-189969630 ATCTGGGCTTTGAAGGAAGAGGG - Intronic
967565062 3:190962902-190962924 TTCTGGGGTCTGAAGGATGGTGG - Intergenic
968350493 3:198048396-198048418 ATCTGGGCTCTGGAGGATGGTGG - Intergenic
968704960 4:2073417-2073439 CACTGGGGCTGGGAGGATGGGGG + Intronic
970213573 4:13735588-13735610 CTCTGGGCCTTGGTGGCTGCTGG + Intergenic
970554188 4:17214975-17214997 TTCTGGGATCTGAAGGATGGTGG + Intergenic
971277876 4:25215318-25215340 TTCTGGGGTCTGAAGGATGGTGG + Intronic
971420417 4:26469104-26469126 CTCTGCTCCCTGAAGGATGCAGG - Intergenic
972190681 4:36587386-36587408 CTCTGGGGTCTGAAGGATGGTGG - Intergenic
972839494 4:42914169-42914191 CTCTAGGGATTGGAGGATGGTGG - Intronic
973293400 4:48490941-48490963 CTCTGGGCCTTGAAGCCGCGCGG - Exonic
973543745 4:51959750-51959772 CTTCGGGCCTTGAGGGATTGTGG - Intergenic
974043935 4:56881559-56881581 CTCTGGGTCTTGGAGGCTGGTGG + Intergenic
974097381 4:57379057-57379079 CTCTGGACCTTGAGTGATAGCGG - Intergenic
974485129 4:62494541-62494563 TTCTGGGGTCTGAAGGATGGTGG - Intergenic
974492773 4:62588499-62588521 CTCTGGGGCCTGGAGGATGGTGG + Intergenic
974679014 4:65137110-65137132 TTCTGGGGTCTGAAGGATGGTGG + Intergenic
974748186 4:66103052-66103074 TTCTGGGGCTTAGAGGATGGTGG - Intergenic
974845991 4:67351652-67351674 TTCTGGGGTTTGGAGGATGGTGG + Intergenic
975312052 4:72913821-72913843 TTCTGGGGTCTGAAGGATGGTGG - Intergenic
976042690 4:80906416-80906438 TTCTGGGGCCTGGAGGATGGTGG + Intronic
976172464 4:82318282-82318304 TTCTGGGGCTTGGAGGATGGTGG - Intergenic
976277200 4:83289842-83289864 TTCTGGGGTCTGAAGGATGGTGG - Intergenic
976805064 4:89037107-89037129 TTCTGGGTCTTGGAAGATGGTGG - Intronic
977436865 4:97008454-97008476 CTCTGTATCTTGAATGATGGTGG - Intergenic
979267811 4:118723924-118723946 CCCTGAGCCTTAAAGGATAGGGG + Intronic
979327832 4:119399950-119399972 TTCTGGGTTCTGAAGGATGGTGG + Intergenic
979749472 4:124260237-124260259 CCCTGTGCATTGCAGGATGGTGG + Intergenic
979824959 4:125221250-125221272 TTCTGGGCTCTGGAGGATGGTGG - Intergenic
980168091 4:129252561-129252583 CTCTGGGGTCTGAAGGACGGTGG - Intergenic
980346876 4:131633440-131633462 TTCTGGGGTTTGGAGGATGGTGG - Intergenic
982524938 4:156466620-156466642 TTCTGGGGTCTGAAGGATGGTGG + Intergenic
983322374 4:166211493-166211515 TTCTGGGGTTTGGAGGATGGTGG + Intergenic
984774306 4:183467321-183467343 TTCTGGGCCCTGGAGGATGGTGG - Intergenic
984865571 4:184277532-184277554 TTCTGGGGCCTGAAGTATGGTGG - Intergenic
985493851 5:193623-193645 CGGTGGGTCCTGAAGGATGGGGG + Intronic
985963871 5:3324861-3324883 CTCTGGGCCTTGCTGGTTGGTGG + Intergenic
986108451 5:4685412-4685434 GTCTGGCCCATGGAGGATGGTGG + Intergenic
986305888 5:6515951-6515973 CACTGGGGCCTGAAGGGTGGAGG + Intergenic
986506755 5:8459541-8459563 CGCTGTGCCTTGAAAGATGAAGG + Intergenic
986783089 5:11084984-11085006 GTCTGTGTCTGGAAGGATGGAGG - Intronic
986975435 5:13388198-13388220 TTCTGGGATCTGAAGGATGGTGG - Intergenic
987895627 5:23942901-23942923 CTCTGGGGTCTGCAGGATGGTGG + Intergenic
988028176 5:25727138-25727160 TTCTGGGGTCTGAAGGATGGTGG + Intergenic
988040903 5:25888060-25888082 TTCTGGGGCCTGGAGGATGGTGG + Intergenic
988199894 5:28054511-28054533 TTCTGGGGTTTGGAGGATGGTGG + Intergenic
989550029 5:42723684-42723706 AGCTGGGCCATGAAGGATGAAGG - Intergenic
990021160 5:51128831-51128853 TTCTGGGGTCTGAAGGATGGTGG - Intergenic
990193268 5:53286139-53286161 CTCTGGGGTCTGGAGGATGGTGG + Intergenic
990448720 5:55916514-55916536 TTCTGGGCCTGGGAGGAAGGTGG + Intronic
992029914 5:72710781-72710803 CTCTTGGCCTTGGTGGATGTGGG - Intergenic
993075610 5:83226356-83226378 CTCTGGGGCTGGAGGGAGGGTGG + Intronic
993799915 5:92319836-92319858 TTCTGGGGTCTGAAGGATGGTGG - Intergenic
993890179 5:93463523-93463545 CTCTGGGGCCTGGAGGATGATGG - Intergenic
993985725 5:94595095-94595117 TTCTGGGGTCTGAAGGATGGTGG + Intronic
994524245 5:100883043-100883065 TTCTGGGGTCTGAAGGATGGTGG - Intronic
994828573 5:104747321-104747343 TTCTGGGGGCTGAAGGATGGTGG - Intergenic
996636169 5:125692299-125692321 TTCTGGGGTTTGGAGGATGGTGG - Intergenic
997390645 5:133512127-133512149 CTTTGGGCTTTGGAGGAGGGAGG - Intronic
998154255 5:139775502-139775524 CTCTGGGCCTGTGAGGATGTTGG - Intergenic
998697064 5:144652610-144652632 TTCTGGGGTCTGAAGGATGGTGG + Intergenic
999037556 5:148369988-148370010 AGCTGGGGTTTGAAGGATGGAGG - Intergenic
999262272 5:150245372-150245394 CCCTGGGCCTCCAAGGAGGGAGG - Intronic
1000548823 5:162633981-162634003 TTCTGGGGTCTGAAGGATGGTGG + Intergenic
1001272686 5:170327418-170327440 CTCTGAGTCTCGAAGGAAGGGGG - Intergenic
1001768369 5:174272982-174273004 CTTTGGGCCTAGAAGGATACAGG + Intergenic
1003259749 6:4506533-4506555 TTCTGGGGTTTGGAGGATGGTGG + Intergenic
1003493348 6:6642526-6642548 CAGTGGGCCTTAAAGGCTGGAGG - Intronic
1004251763 6:14028715-14028737 ATGTGAGCCTTGAAGGGTGGAGG + Intergenic
1004756700 6:18618151-18618173 TTCTGGGGTCTGAAGGATGGTGG + Intergenic
1004852634 6:19715822-19715844 TTGTGGGAATTGAAGGATGGGGG + Intergenic
1005983027 6:30851951-30851973 TTCTGGGGTTTGGAGGATGGTGG - Intergenic
1006168290 6:32078861-32078883 CTCAGGGCCATGAAAGCTGGTGG + Intronic
1006730180 6:36230642-36230664 CTCTGTGCCCTGCGGGATGGAGG - Exonic
1007367980 6:41407963-41407985 CTCTGAGCCTGGCAGGAAGGAGG - Intergenic
1007444690 6:41895679-41895701 CTCTGGCCCTTTAAGGAGGAGGG - Intergenic
1007556698 6:42772372-42772394 AGCTGGGCCTTGAAGAATGGTGG + Intronic
1009289455 6:61866049-61866071 TTCTGGGCTCTGGAGGATGGTGG + Intronic
1009377513 6:62990745-62990767 TTCTGGGGCCTGGAGGATGGTGG + Intergenic
1009792418 6:68420273-68420295 CTCTGGGGTCTGGAGGATGGTGG - Intergenic
1009816922 6:68748678-68748700 TTCTGGACCCTGGAGGATGGTGG + Intronic
1010236328 6:73577877-73577899 ATCTGGGCCTTGAAGGTAGATGG + Intergenic
1010464549 6:76151518-76151540 CTCTGGACCCTAAGGGATGGTGG + Intergenic
1010958964 6:82123742-82123764 CTCTGGATTTTGGAGGATGGAGG + Intergenic
1012349415 6:98232566-98232588 TTCTGGGCTCTGGAGGATGGTGG + Intergenic
1012762308 6:103317707-103317729 TTCTGGGGCCTGGAGGATGGTGG - Intergenic
1013154000 6:107475820-107475842 AGCTGGGCCTTGAAGGATGATGG - Intergenic
1013154289 6:107478190-107478212 AGCTGGGCCTTGAAGGATGATGG + Intergenic
1013265064 6:108488401-108488423 AACTGGGCCTTGAAGGCTGGAGG + Intronic
1014422009 6:121257896-121257918 GTCTGGGCCAGGAAGTATGGAGG - Intronic
1015178649 6:130338464-130338486 CTCTGGGGTCTGGAGGATGGTGG - Intronic
1017525351 6:155237420-155237442 ATCTGGGCTCTGGAGGATGGTGG + Intronic
1017788726 6:157776765-157776787 CTCTGGTGGATGAAGGATGGTGG + Intronic
1019132707 6:169889049-169889071 CTCTGAGCCTTGTAGGATGAAGG + Intergenic
1019888921 7:3929708-3929730 ATCCAGCCCTTGAAGGATGGTGG + Intronic
1022091156 7:27108821-27108843 CTCTGGGACCTGACGGATGCAGG - Intronic
1022512855 7:30952294-30952316 TTCTGGGGTCTGAAGGATGGTGG + Intronic
1022818663 7:33937564-33937586 ATCTGGGGCTGGAAGGAAGGGGG + Intronic
1023222169 7:37930414-37930436 CTCTTGGGAGTGAAGGATGGGGG + Intronic
1024668125 7:51565870-51565892 AGCTGGGCTTTGAAGGATGCAGG - Intergenic
1025737098 7:64160637-64160659 CACTGGGGCTTGTCGGATGGTGG + Intronic
1026208445 7:68280012-68280034 CTCAGGGCCTGCAAGGCTGGAGG - Intergenic
1027300372 7:76827748-76827770 CTCTGGGGTCTGGAGGATGGTGG + Intergenic
1027605323 7:80292486-80292508 TTCTGGGGTCTGAAGGATGGTGG + Intergenic
1027831448 7:83182699-83182721 TTCTGGGGTCTGAAGGATGGTGG + Intergenic
1028143706 7:87298747-87298769 TTCTGGGCCCTGGAAGATGGTGG + Intergenic
1028866746 7:95722475-95722497 TTCTGGAACTTGGAGGATGGGGG - Intergenic
1028968416 7:96828423-96828445 AACTGGGCCTGGAAGAATGGGGG - Intergenic
1029514408 7:101016799-101016821 CCTTGGGCCCCGAAGGATGGGGG + Intronic
1030583983 7:111393699-111393721 CTCTTGGGCGTGAGGGATGGTGG - Intronic
1030712961 7:112774505-112774527 CTCTGGGCCTGAGAGGCTGGAGG - Intronic
1030851023 7:114486976-114486998 CTCTGGGGTCTGGAGGATGGTGG + Intronic
1031262040 7:119533353-119533375 CTCTGGGGTCTGGAGGATGGTGG - Intergenic
1031301648 7:120068303-120068325 CTCTGGGATCTGGAGGATGGTGG - Intergenic
1032639421 7:133749309-133749331 CTCTGGGTCCTGATGGATGGTGG + Intronic
1033121673 7:138671940-138671962 CTCTCAGCCCTGCAGGATGGAGG + Intronic
1033258747 7:139823920-139823942 CTCTTTGCCATGAAGGATGCTGG - Intronic
1033837716 7:145335655-145335677 TTCTGGGGCCTGGAGGATGGTGG + Intergenic
1034166077 7:149026277-149026299 CACTGGGAGTTTAAGGATGGAGG + Intronic
1034874481 7:154713310-154713332 TTCTGGGATCTGAAGGATGGTGG + Intronic
1035253457 7:157612070-157612092 CTCTGGGCCTGGAGGGCTGCAGG - Intronic
1035272338 7:157727922-157727944 CTCTGAGTGTGGAAGGATGGAGG - Intronic
1035473890 7:159128920-159128942 CCCTGGAGCTTGAAGGGTGGTGG - Intronic
1035669786 8:1408501-1408523 CTCTGGGCCTTGGATGATGAGGG + Intergenic
1036703211 8:11027831-11027853 CTGTGGGCCTTGTAGGTAGGAGG - Intronic
1036798660 8:11773586-11773608 AGTTGGGCCTTGAAGGCTGGAGG + Intronic
1037258592 8:16982192-16982214 CTCTGGGGCTTGAGGGGTTGCGG + Intergenic
1037448921 8:18997291-18997313 CTGTGCATCTTGAAGGATGGAGG - Intronic
1037926079 8:22845139-22845161 TTCTAGTCCTTGAAGGATGAAGG + Intronic
1037979077 8:23237828-23237850 TTCTGGGGTCTGAAGGATGGTGG + Intergenic
1038492888 8:27982729-27982751 TGCGGGGCCTTGAAGGATGCAGG + Intronic
1038669490 8:29570994-29571016 CTCTGGGAAGTGAAGGCTGGTGG - Intergenic
1038873997 8:31527995-31528017 CTATGGGTGTTGAAGCATGGTGG + Intergenic
1038880436 8:31605242-31605264 TTCTGGGGTTTGGAGGATGGTGG + Intergenic
1039792658 8:40887987-40888009 CCCTGAGCATTGAAGGATGAGGG - Intronic
1041720025 8:60967403-60967425 CACTGGGCGGTGAAGGATGGTGG + Intergenic
1041781318 8:61580211-61580233 TTCTGGGGCCTGCAGGATGGTGG + Intronic
1042992399 8:74655785-74655807 TTCTGGGGTCTGAAGGATGGTGG - Intronic
1043463424 8:80483072-80483094 CTCTGAGCCCTGAAAGAAGGTGG - Intergenic
1044732034 8:95236758-95236780 ATCTGTGCCTTCAAGGTTGGGGG + Intergenic
1045214132 8:100130005-100130027 TTCTGGGGTCTGAAGGATGGTGG + Intronic
1045499694 8:102735590-102735612 CACTGGGCCATAAAGGAGGGAGG + Intergenic
1045808670 8:106195855-106195877 CTCTGGGAGTAGAATGATGGAGG + Intergenic
1045994001 8:108341887-108341909 AGCTGGGCCTTAAAGAATGGGGG + Intronic
1046400908 8:113702583-113702605 TTCTGGGCTCTGGAGGATGGTGG + Intergenic
1046656377 8:116899445-116899467 TTCTGGGACCTGGAGGATGGTGG - Intergenic
1046735203 8:117768989-117769011 CTCTGGGGTCTGGAGGATGGTGG - Intergenic
1047490384 8:125369665-125369687 TTCTGGGGGTTGAAGGATGGTGG + Intergenic
1047865901 8:129023984-129024006 TTCTGGGATTTGAAGGACGGTGG - Intergenic
1048319188 8:133385359-133385381 CCCTGGGCCTGCAAGGGTGGGGG - Intergenic
1048923400 8:139250511-139250533 TTCTGGGGTCTGAAGGATGGTGG - Intergenic
1049967908 9:796008-796030 CTCTGGGCCTGGGTGGAGGGTGG + Intergenic
1050102880 9:2136926-2136948 CTCTGGGAGTTTGAGGATGGTGG - Intronic
1050929008 9:11300975-11300997 TTCTGGGGTTTGGAGGATGGTGG + Intergenic
1051878728 9:21818087-21818109 ATCTGGGCTTTGAAGGAAGAGGG + Exonic
1052557099 9:30031931-30031953 CTCTGGGGTCTGGAGGATGGTGG + Intergenic
1053063686 9:35051254-35051276 TTCTAGGCCTTAAAGGAAGGTGG - Intergenic
1053273164 9:36763747-36763769 CTGAGGGCCTTGGAGGAAGGAGG + Intergenic
1055102260 9:72478224-72478246 ATCTGGGCTTTGAAGAATGGGGG + Intergenic
1055441252 9:76338648-76338670 CTCTGGGCCTTGAAGGATGGGGG - Intronic
1057206715 9:93177916-93177938 ATCTGGGCCTAGAGAGATGGGGG - Intergenic
1057645133 9:96866624-96866646 TTCTGGGGTCTGAAGGATGGTGG - Intronic
1057898618 9:98930210-98930232 CTCAGGGCCTGGAGTGATGGGGG + Intergenic
1058843559 9:108934014-108934036 CACTAGGCCTCCAAGGATGGAGG + Exonic
1059343122 9:113610721-113610743 TTCTAGGCCCTGAGGGATGGAGG + Intergenic
1059566263 9:115385683-115385705 CCCTGAGCCTGCAAGGATGGGGG - Intronic
1059753579 9:117271947-117271969 TTCTGGGGTCTGAAGGATGGTGG + Intronic
1059915320 9:119093289-119093311 CTGTGGGGATGGAAGGATGGAGG + Intergenic
1060098880 9:120819870-120819892 ATCTGGGTCTTGAAGGATACAGG - Intronic
1060836467 9:126758745-126758767 CTCTGTCCCTGGCAGGATGGAGG - Intergenic
1061720820 9:132550185-132550207 CTCTGGAGCTGGAAGGATGAAGG - Intronic
1062195369 9:135270552-135270574 TTCTGGGCGGTGAAGGATCGGGG - Intergenic
1185675464 X:1845591-1845613 CTCTAGGCCGTGTAGGAAGGAGG - Intergenic
1185767919 X:2741020-2741042 CCCCGGGCCTTGGAGAATGGGGG - Exonic
1186742649 X:12534424-12534446 TTCTGGGGTCTGAAGGATGGTGG - Intronic
1187002750 X:15199542-15199564 CTCTGGGTTCTGGAGGATGGTGG + Intergenic
1187836575 X:23437506-23437528 TTCTGGGATCTGAAGGATGGTGG - Intergenic
1188457182 X:30380054-30380076 TTCTGGGGTTTGGAGGATGGTGG - Intergenic
1189014052 X:37077553-37077575 CTCGGGGTCTCTAAGGATGGAGG - Intergenic
1190725870 X:53190232-53190254 ATCTGGGTCTTGCAGGATGATGG + Intergenic
1190984771 X:55490180-55490202 CTCTGGGAGTTGACGGAGGGAGG + Intergenic
1192071062 X:67941636-67941658 TTCTGGGGTCTGAAGGATGGTGG + Intergenic
1192263896 X:69525403-69525425 CTCTGGGGCTCAAAAGATGGAGG + Intronic
1193346645 X:80411881-80411903 TTCTGGGGTTTGGAGGATGGTGG + Intronic
1193485190 X:82078623-82078645 TTCTGGGTTCTGAAGGATGGTGG + Intergenic
1193509104 X:82377800-82377822 TTCTGGGATTTGGAGGATGGTGG + Intergenic
1193662469 X:84274138-84274160 TTCTGGGGCCTGGAGGATGGTGG + Intergenic
1193707848 X:84844707-84844729 TTCTGGGGTCTGAAGGATGGTGG + Intergenic
1193777202 X:85657649-85657671 TTCTGGGGCCTGGAGGATGGTGG - Intergenic
1194032700 X:88836042-88836064 TTCTGGGGTCTGAAGGATGGTGG + Intergenic
1194507107 X:94746138-94746160 TTCTGGGGCCTGGAGGATGGTGG - Intergenic
1194920635 X:99760226-99760248 TTCTGGGGCCTGGAGGATGGTGG - Intergenic
1194943562 X:100041579-100041601 CTCTGGGGTCTGGAGGATGGTGG + Intergenic
1195195184 X:102490355-102490377 TTCTGGGGTCTGAAGGATGGTGG + Intergenic
1195608321 X:106834977-106834999 TTCTGGGGTCTGAAGGATGGTGG + Intronic
1196559345 X:117126842-117126864 TTCTGGGATCTGAAGGATGGTGG - Intergenic
1197057122 X:122134884-122134906 CTCTGGGGTCTGGAGGATGGTGG - Intergenic
1197128712 X:122978840-122978862 AGCTAGGCCTTGAAGGATGGAGG + Intergenic
1197851769 X:130869742-130869764 ATCTGAGTCTTGAAGGATGGTGG - Intronic
1198872856 X:141194085-141194107 TTCTGGGCTCTGAAGGATGGTGG - Intergenic
1198882500 X:141296105-141296127 CACTGGGTTGTGAAGGATGGTGG + Intergenic
1199193327 X:144997540-144997562 TTCTGGGGTCTGAAGGATGGTGG - Intergenic
1199220294 X:145309368-145309390 TTCTGGGGTCTGAAGGATGGTGG + Intergenic
1199289873 X:146093650-146093672 TTCTGGGGTCTGAAGGATGGTGG + Intergenic
1199864111 X:151827636-151827658 CTGTGGGCCTGGAAGGAAGGAGG - Intergenic
1200088448 X:153623347-153623369 CTCTGGGGCCCGAAGGATGTAGG - Intergenic
1202030804 Y:20572390-20572412 TTCTGGGGTTTGGAGGATGGTGG + Intergenic