ID: 1055442151

View in Genome Browser
Species Human (GRCh38)
Location 9:76347183-76347205
Sequence CTACACAGAAAGATGCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 180}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055442151 Original CRISPR CTACACAGAAAGATGCAGCT TGG (reversed) Intronic
901028311 1:6291010-6291032 CCACAGAGACAGAGGCAGCTTGG + Intronic
904619159 1:31765109-31765131 CTACACAAACAGATGCAACATGG - Intergenic
906939493 1:50243947-50243969 CTACACTGGAAGCTGCAGCAGGG + Intergenic
911037478 1:93566121-93566143 CTACAGAGGGAGGTGCAGCTGGG - Intronic
912099541 1:106189160-106189182 CTACAAAGACATATGCAGCCGGG + Intergenic
913367209 1:118052938-118052960 CTACTCTCAAAGATGCAGTTAGG + Intronic
917519077 1:175733390-175733412 CCACAAAGAAGGATGCTGCTTGG + Intronic
919041816 1:192398549-192398571 CTACACAGAAAGATGGAGGAAGG + Intergenic
919774825 1:201187615-201187637 CTACCCAGGAAGATGGAGCTGGG - Intergenic
921698764 1:218243880-218243902 CTACCCAGAAAGCTGAAGCAGGG + Intergenic
923120111 1:230981990-230982012 CTATAGAGAAAGATAAAGCTGGG - Intronic
923201699 1:231718729-231718751 CTAAAGAGAAAGTTGCAGCCAGG - Intronic
1063036880 10:2295038-2295060 ATACACAGTAAGATGAAGCATGG + Intergenic
1063585085 10:7345087-7345109 CTTCACAGAGAGATGGAGCCAGG + Intronic
1063752354 10:8964860-8964882 CCACACAGTAAGCTGCAGCTGGG + Intergenic
1065482623 10:26211018-26211040 CTACACAGAAAAGTAAAGCTGGG - Intronic
1068946881 10:62738605-62738627 GTACCCAGCAAGATGCAGATGGG + Intergenic
1069843048 10:71351950-71351972 CTACTCACAAATTTGCAGCTTGG + Intronic
1072069057 10:91898972-91898994 ATAAAAAGAAAGAAGCAGCTGGG - Intergenic
1072135799 10:92544518-92544540 CTACAGAGAAAGAGGAAGCGTGG + Intronic
1074400398 10:113136915-113136937 CCAAACAGAAAGATGCCCCTTGG - Intronic
1076514108 10:131033537-131033559 ATACGCAGAAAGATGGAGGTTGG + Intergenic
1076678097 10:132158424-132158446 CCTCACAGAAAGCTGAAGCTGGG - Intronic
1078040507 11:7858035-7858057 TTGCTCAGAAACATGCAGCTAGG - Intergenic
1078441458 11:11372023-11372045 ATAAACAGCAAGATGCAGCCAGG - Intronic
1079026349 11:16950876-16950898 GTGCAGAGAAAGATGTAGCTGGG - Intronic
1081193076 11:40128128-40128150 CTACTTAGGAAGGTGCAGCTCGG - Intronic
1081680520 11:44999221-44999243 CTACCCAGAAAGCTGCAGAGAGG - Intergenic
1084320518 11:68370914-68370936 TGAGACAGAAAGATGCAACTGGG + Intronic
1085193879 11:74654210-74654232 TTAAACATAAAGATGCAGATAGG + Intronic
1090200181 11:124848506-124848528 CTACACAATGAGATGCATCTAGG - Intergenic
1090911263 11:131121632-131121654 CTACATGGGAAGATGAAGCTGGG + Intergenic
1092686600 12:11055798-11055820 CTACACTGTTATATGCAGCTCGG + Intronic
1097578452 12:61423956-61423978 CTCCACAGAAACATGCAGACTGG - Intergenic
1097860105 12:64510347-64510369 CTACACAGAAGGGTGGAGCAAGG - Intergenic
1098028132 12:66227247-66227269 CTAAAGAGAAAGAGGCAGCCTGG + Intronic
1100650269 12:96579712-96579734 CTACAGAGAAAAAGGGAGCTAGG - Intronic
1101049001 12:100841490-100841512 CTACAAAGAAAGATGAAGCTGGG + Intronic
1101083613 12:101213604-101213626 GTACAGAGAAAGATGCACTTTGG + Intergenic
1102950534 12:117027952-117027974 CTGCACAGACAGAAGCGGCTGGG + Intronic
1102960683 12:117091508-117091530 CAAGAAAGAAAGATGCAGCGGGG + Intronic
1103879711 12:124156673-124156695 CTACACAGAAACCTGCATATAGG - Intronic
1105839901 13:24245093-24245115 CACCAAAGAAACATGCAGCTGGG - Intronic
1106001117 13:25724291-25724313 CTCCAGAGAAAGATTCAGCCTGG + Intronic
1107602164 13:42024674-42024696 CTAGACAGAAAGTAGCAGCTCGG + Intergenic
1107924247 13:45243189-45243211 GTACACAGAAGGATGGAGGTAGG - Intronic
1108911209 13:55553691-55553713 CTCCAGAGAAAGATGCAGTGGGG + Intergenic
1111684280 13:91482714-91482736 CTAAACAGCAAGAAGCAGCGTGG - Intronic
1111793195 13:92884804-92884826 CTATAAAGAGAGTTGCAGCTTGG + Intergenic
1114856102 14:26446410-26446432 TTGCACAGAAAGGAGCAGCTGGG + Exonic
1118063751 14:62168191-62168213 CTACCCAGAAAGATGTAAGTAGG - Intergenic
1119394310 14:74314952-74314974 CTACACAGAAGGATGGAGGAAGG + Intronic
1121084868 14:91138194-91138216 CTATAAAGAAATACGCAGCTGGG + Intronic
1122541476 14:102499971-102499993 AGACACAGAGAGATGCAGCCCGG - Exonic
1125715705 15:41818818-41818840 CGCCACACAAATATGCAGCTGGG - Exonic
1125869725 15:43088730-43088752 CTACACAGAGGGAAGGAGCTGGG + Intronic
1127890815 15:63249373-63249395 ATACACAGAAAAATCCTGCTAGG - Intronic
1127940160 15:63687117-63687139 CTACACAGAATGATGTATATAGG + Intronic
1128260297 15:66228430-66228452 CCCCAGAGAAAGAGGCAGCTGGG + Intronic
1129813908 15:78535157-78535179 GTAGACAGAAAGATGGAGATAGG - Exonic
1131066870 15:89440112-89440134 CTAGGCATAGAGATGCAGCTGGG - Intergenic
1132774664 16:1586405-1586427 CTGGGCAGAAAGATGCAGCCAGG - Intronic
1135160209 16:20087665-20087687 CAACAGACAAAAATGCAGCTAGG - Intergenic
1136222312 16:28836303-28836325 CTTCACAGACAGGTGCAGGTCGG - Intronic
1137445678 16:48530603-48530625 CTGCACAGGCAGATGCAGCAAGG - Intergenic
1139226302 16:65235801-65235823 CTCCTCAGCAAGAGGCAGCTTGG - Intergenic
1139772116 16:69286386-69286408 CTACAATGAAAAATGAAGCTGGG + Intronic
1140223708 16:73062942-73062964 CTACCCAGACAGATGCACTTCGG - Intergenic
1141848044 16:86624364-86624386 ATAAAGAAAAAGATGCAGCTAGG - Intergenic
1142622153 17:1172055-1172077 CTAGACCGAAAGATGAATCTGGG - Intronic
1145772970 17:27506696-27506718 CACCACAGAAAAATGCAGCTTGG - Intronic
1146296895 17:31657396-31657418 CTAAACAGAAACATGCAGCTGGG + Intergenic
1146823023 17:35999854-35999876 CTAAATAGAAAAATGCAGCCAGG + Intronic
1149532395 17:57406046-57406068 CTTCTGAGAAAGATGCTGCTTGG - Intronic
1150443066 17:65207306-65207328 CTACACATGAAGATCCACCTTGG - Intronic
1150665419 17:67131376-67131398 CTTCACAAAAAGCTGGAGCTTGG + Intronic
1151151790 17:72094779-72094801 CACCAGAGAAAGATGCAGCAGGG - Intergenic
1151714741 17:75825556-75825578 GTACAGAGAGAGATGCAGCAGGG + Exonic
1151966776 17:77435629-77435651 TGACACAGAATGAAGCAGCTAGG + Intronic
1152387304 17:79982437-79982459 CTTTACAGAAAAATGAAGCTGGG - Intronic
1153132537 18:1872645-1872667 TTTCAGAGAAAGAAGCAGCTGGG + Intergenic
1153218844 18:2845332-2845354 TCACACAGAAAGATACAGATTGG + Intergenic
1153774636 18:8441791-8441813 TGACACAGGAAGATCCAGCTTGG - Intergenic
1154332584 18:13441965-13441987 TTCCACAGAAAGATGCAGCCAGG - Intronic
1157311963 18:46559607-46559629 AGACACAGAAAGATGCAGTGTGG + Intronic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1158432475 18:57401718-57401740 CTACACAGAAGTTTGGAGCTGGG - Intergenic
1159982172 18:74796448-74796470 CTATATAGAAAAATGCAGCTTGG - Intronic
1160202040 18:76804021-76804043 CTACACTGAAAGATTCGGATGGG - Intronic
1163360888 19:16845622-16845644 CTACACAGACAGAAGAGGCTAGG - Intronic
1163905302 19:20147206-20147228 TTACATAGTAAAATGCAGCTGGG - Intergenic
1164436328 19:28233069-28233091 CTACAGAGAAAGCTGCAGACTGG + Intergenic
1165069372 19:33246984-33247006 CCACCCAGAAAGATGCAGCCAGG - Intergenic
1165294379 19:34914984-34915006 CAAGACAGAAAGATGAAGCTGGG + Intergenic
1167383873 19:49153034-49153056 CCACACCCCAAGATGCAGCTTGG + Intronic
1168111289 19:54192557-54192579 CAAAAAAGAAAAATGCAGCTGGG - Intronic
927145200 2:20160657-20160679 CTACACAGACAAAGGCAGTTAGG + Intergenic
927247187 2:20966747-20966769 CTAGAAAGAAAGATCCAGGTAGG + Intergenic
927286047 2:21358104-21358126 CTACACTGGAAGATGGTGCTGGG - Intergenic
927317317 2:21699126-21699148 CTGCACACAAACCTGCAGCTTGG + Intergenic
927563868 2:24093910-24093932 CTACAAAGACACATGCAGCCAGG - Intronic
927899404 2:26808412-26808434 CACAACAGAAAGATGCAGGTGGG - Intergenic
928233707 2:29522026-29522048 CACCATAGAAAAATGCAGCTGGG + Intronic
929158371 2:38808596-38808618 ATATACACAAAGATACAGCTAGG - Intronic
930228977 2:48824622-48824644 CTATACTGAAGGATGCAGCTTGG + Intergenic
931639693 2:64370876-64370898 CTTAACAGATAGATACAGCTGGG + Intergenic
931985404 2:67736736-67736758 CTGCACAGAAACATGAAGTTAGG - Intergenic
932348202 2:71009503-71009525 CAACAGAGAAGGATGCAGCATGG - Intergenic
932351079 2:71032383-71032405 CAACAGAGAAGGATGCAGCATGG - Intergenic
936614363 2:114033492-114033514 CTACACAGAAAGAGGCAGATTGG + Intergenic
940799049 2:158113106-158113128 ATGCACAGACAGAAGCAGCTTGG - Intronic
941561765 2:167055330-167055352 CTACATAGAGAGAAGCAGTTGGG - Intronic
941573821 2:167205036-167205058 CTAGAGAGAAAGATGCAGAAAGG - Intronic
941769567 2:169330218-169330240 ATACTCAGAAACATCCAGCTTGG - Intronic
941873697 2:170411817-170411839 CTCCACAGCCAGATGCAGCCAGG - Intronic
942224029 2:173798849-173798871 CTACACAGAAAGATGAATAAAGG + Intergenic
946428421 2:219612178-219612200 CCACACAGCAAGAAGCTGCTGGG - Intronic
948063429 2:235058872-235058894 CCACACAGAAGGATGCAGGAAGG - Intergenic
1169407645 20:5336478-5336500 TTAAACAGAAAGATGCCCCTGGG - Intergenic
1171338920 20:24411995-24412017 CTACACCCAACAATGCAGCTCGG + Intergenic
1172210157 20:33191683-33191705 GTAAACAGAAAGATCCAGTTTGG - Intergenic
1176793823 21:13354444-13354466 CTTCACTGAAAGCAGCAGCTTGG - Intergenic
1178785071 21:35646103-35646125 CCACAGAGATAGATGCAGATTGG + Intronic
1179073002 21:38090471-38090493 CTTCACAGCAACATGCAGCCTGG + Intronic
1180698584 22:17769700-17769722 CTCCACACACAGAGGCAGCTGGG + Intronic
949791964 3:7802458-7802480 CTACACAGAAAGATAGGGGTAGG - Intergenic
950762363 3:15243357-15243379 CTCCAAATGAAGATGCAGCTAGG + Intronic
954442426 3:50529115-50529137 TTGGACAGAAAGAGGCAGCTAGG - Intergenic
958037554 3:88188475-88188497 CTTCACAGAAAGATTTAGCCTGG - Intergenic
962662217 3:137614333-137614355 CTACAAAGCAAAATGCACCTGGG + Intergenic
969160561 4:5254078-5254100 CTACAAAAAAAGATTCAGCTGGG - Intronic
971580334 4:28330625-28330647 ATACACAGAAACCTGCAACTAGG + Intergenic
972073694 4:35056417-35056439 TTACACAGAAAGGTGGAGTTGGG + Intergenic
979560706 4:122098363-122098385 CTACACAGTAGTATGCATCTTGG - Intergenic
980844317 4:138305730-138305752 CAACACAGAAACATGCATATAGG - Intergenic
981228512 4:142324943-142324965 CTAGACAGAGAGCTGCTGCTTGG - Intronic
981535384 4:145794574-145794596 CTACTCAGAAAGCTGAGGCTGGG + Intronic
986432747 5:7697877-7697899 CTACTCTGAAAGACTCAGCTGGG + Intronic
986506917 5:8461650-8461672 CTACACAGAAAGTTGGAGACAGG - Intergenic
987238860 5:15972066-15972088 CTACACAGAAAGATGGGGATGGG - Intergenic
990814418 5:59767657-59767679 CTACGCAGAAAGTTGCAGGCTGG - Intronic
993026799 5:82656415-82656437 ATACACAGAGAGATGAAGTTTGG + Intergenic
998651040 5:144122066-144122088 CTAGACAAAAAGAGGCGGCTTGG + Intergenic
1001292991 5:170478080-170478102 CTGCACTGAAAGATGGAGGTAGG - Intronic
1001692321 5:173642380-173642402 CCAAGCAGAAAGCTGCAGCTTGG + Intergenic
1005809647 6:29506145-29506167 CTACAGAGCAAGCAGCAGCTGGG + Intergenic
1007865394 6:44963702-44963724 TTACAAAAAAAGTTGCAGCTGGG + Intronic
1008754471 6:54777741-54777763 CTACACAAAAAGATGGACCATGG - Intergenic
1008962674 6:57281689-57281711 CTACACAGAGAGGTGCTCCTGGG + Intergenic
1010883189 6:81204774-81204796 ATACACTGAAAGATGCAGAGGGG - Intergenic
1011435902 6:87336418-87336440 CTACCCAGAAAGTTGCTGATTGG + Intronic
1012389359 6:98719885-98719907 CTAAACAGAAACATTCACCTGGG + Intergenic
1012519394 6:100102968-100102990 CTACAGAGAAAGAAGAAGGTGGG - Intergenic
1014740935 6:125147014-125147036 CTACACAGAAAGGTGGGGCAAGG + Intronic
1014962406 6:127703491-127703513 GTACACAGGAAGCTGCAGCTTGG - Intergenic
1017810441 6:157980545-157980567 CTACACAGAAAGAAGCTGCTCGG + Intergenic
1018524554 6:164694265-164694287 TAACTTAGAAAGATGCAGCTGGG - Intergenic
1018750347 6:166798776-166798798 CTCCACAGACAGGTGCATCTTGG + Intronic
1020225976 7:6280281-6280303 CTACACAGAAAATTCCAGCTGGG + Intergenic
1021881792 7:25102088-25102110 CTACTGATAAAGATGAAGCTGGG - Intergenic
1022526214 7:31039088-31039110 CTTCACAGACACATCCAGCTCGG - Intergenic
1022956840 7:35389037-35389059 CACCACAGAAAGGTGGAGCTGGG + Intergenic
1027968712 7:85048252-85048274 CAACACAGATAGATGTAGATTGG - Intronic
1030373296 7:108725371-108725393 CAACTCAGAAAGCAGCAGCTAGG - Intergenic
1032249997 7:130247820-130247842 ATACACACAAAGATGTACCTAGG - Intergenic
1032621499 7:133538293-133538315 CTATACAGTATGATTCAGCTGGG + Intronic
1033569597 7:142614843-142614865 CTACAGAGAATGATACAGATAGG + Intergenic
1034333688 7:150306370-150306392 GTAGACAGAAGGAAGCAGCTGGG + Intronic
1034664355 7:152803520-152803542 GTAGACAGAAGGAAGCAGCTGGG - Intronic
1035585778 8:772431-772453 CTACTCAGGAGGTTGCAGCTGGG - Intergenic
1036180722 8:6582427-6582449 ATACACAGATAGATGCACTTTGG - Intronic
1038533054 8:28334275-28334297 CTACAGAGAAAGAGTCACCTGGG - Intronic
1043439642 8:80265887-80265909 GTCCACCGGAAGATGCAGCTGGG + Intergenic
1044081744 8:87893777-87893799 ATACACGGAATGATGCAGTTTGG - Intergenic
1044665858 8:94633697-94633719 ATACACAGAAAAATACAGATAGG - Intergenic
1044827691 8:96214049-96214071 TTACACAGAAAGTTAGAGCTGGG + Intergenic
1045641972 8:104261233-104261255 CTTCTCAGAAAGGAGCAGCTGGG + Intergenic
1046363488 8:113193091-113193113 TAACTCAGAAAGCTGCAGCTAGG - Intronic
1049423183 8:142525803-142525825 CTCTGCAGAAAGATGCTGCTAGG - Intronic
1050456739 9:5841628-5841650 CTCCACTAAAACATGCAGCTGGG + Intergenic
1050921617 9:11209730-11209752 CTAAACAGAAAAATAGAGCTGGG - Intergenic
1052604825 9:30686407-30686429 CTATAAAGACACATGCAGCTGGG + Intergenic
1055442151 9:76347183-76347205 CTACACAGAAAGATGCAGCTTGG - Intronic
1057904362 9:98972830-98972852 GAACACAGAAGTATGCAGCTGGG + Intronic
1057949794 9:99360563-99360585 CAAAACAGAAAAATGAAGCTGGG - Intergenic
1058954755 9:109935441-109935463 CTACACAGAAACATGTGCCTTGG - Intronic
1060548474 9:124474444-124474466 CTACAGAGAAAGATCAGGCTGGG + Intronic
1189996974 X:46648210-46648232 CTCCACAGAAAGTTAGAGCTGGG + Intronic
1193696389 X:84711416-84711438 CTACACAGAAAGAAACACCCAGG - Intergenic
1195462694 X:105145436-105145458 GTACACAGAAGGAGGCAGGTTGG + Intronic
1197721137 X:129745453-129745475 CTACACAGAAAGTGGCTGGTGGG - Intronic
1197783190 X:130176690-130176712 ACACACAGAAAGAAGCAGCAAGG - Intronic
1198581160 X:138066276-138066298 CTGCCCAGAATGATGGAGCTGGG - Intergenic
1200391706 X:155952190-155952212 CTTAACAAAAAGATGCAGCAAGG + Intergenic
1201567110 Y:15376850-15376872 CTACTCACAACCATGCAGCTAGG + Intergenic
1202162736 Y:21952448-21952470 CAACACAAAACGATGCAGTTTGG - Intergenic
1202228620 Y:22633920-22633942 CAACACAAAACGATGCAGTTTGG + Intergenic
1202314537 Y:23562247-23562269 CAACACAAAACGATGCAGTTTGG - Intergenic
1202556265 Y:26108348-26108370 CAACACAAAACGATGCAGTTTGG + Intergenic