ID: 1055450135

View in Genome Browser
Species Human (GRCh38)
Location 9:76423448-76423470
Sequence ACTAGGAAGTTCAAGGTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 318}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055450135 Original CRISPR ACTAGGAAGTTCAAGGTCAT GGG (reversed) Intronic
902643475 1:17781544-17781566 ACCAGGAACTTCTAAGTCATTGG + Intronic
902710971 1:18239488-18239510 AAGACCAAGTTCAAGGTCATTGG + Intronic
905534160 1:38706494-38706516 GCTAGGGTGTTCAGGGTCATTGG - Intergenic
908469168 1:64425463-64425485 GCTAGGAAGTTCAAGGTCAAGGG + Intergenic
908943726 1:69468622-69468644 GCTGGGAAGTTCAAGGGCATAGG + Intergenic
909451514 1:75802815-75802837 GCTGGGAAGTCCAAGGTCAAAGG + Intronic
909760312 1:79277868-79277890 GCTGGGGAGTTCCAGGTCATAGG - Intergenic
909917003 1:81332968-81332990 ACTAGGAAGTTCAGCGACCTGGG + Intronic
909974945 1:82035058-82035080 GCTGGGAAGTTCAAGGTAAAGGG - Intergenic
910010994 1:82461883-82461905 GCTGGGAAGTTCAAGATCAAGGG - Intergenic
912041721 1:105398607-105398629 TCTAGGAAGTAAAAGGTCACAGG + Intergenic
912465002 1:109866317-109866339 ACTAGGAAATTAAAGATCAAGGG + Intergenic
912958379 1:114172717-114172739 GCTGGGAAGTCCAAGATCATGGG - Intergenic
913553636 1:119941334-119941356 AATAGAAAGTTAAAGGTCAGAGG - Intronic
915639178 1:157208762-157208784 GCTTGGAAGTCCAAGGTCAAGGG - Intergenic
915644889 1:157263026-157263048 GCTGGGAAGTTCAAGATCAAGGG + Intergenic
915848322 1:159293005-159293027 ACTGTGAAGTTCAAGGTCAAGGG - Intronic
916018469 1:160771934-160771956 ACTGGGAAGTCCAAGATCAAGGG - Intergenic
916301288 1:163277206-163277228 AGCAGGAGGTTCCAGGTCATAGG - Intronic
916501425 1:165390685-165390707 ACTGGGAAGTCCAAGATCAAAGG + Intergenic
916801265 1:168218806-168218828 ACTGGGAAGTTCAAGATCAATGG + Intergenic
917871257 1:179244095-179244117 ACTAGGAAGTCCAAGATCGTGGG - Intergenic
918545898 1:185683604-185683626 CCTGAGAAGTTCAAGGTCAAGGG + Intergenic
919847932 1:201653332-201653354 ACTAGGAAGTCCAGGTTCCTGGG - Intronic
920828562 1:209445405-209445427 ACTTGGAAGATGAAGGTCAGTGG + Intergenic
921072979 1:211677345-211677367 GCTAGGAAGTCCAAGATCAAGGG - Intergenic
921327572 1:214001898-214001920 ACTAGGAAGTTCACCATAATCGG - Intronic
922760895 1:228129841-228129863 GCTAGGAAGTCCAAAGTCAAGGG - Intergenic
922761123 1:228131471-228131493 GCTAGGAAGTCCAAAGTCAAGGG + Intergenic
922786336 1:228284227-228284249 GCTGGGAAGTCCAAGGTCAAGGG + Intronic
922877613 1:228952185-228952207 ACTGGAAAGCTCAAGGTCAGAGG - Intergenic
923220200 1:231885963-231885985 ACTGGGAAGTTCAAGATCAAGGG + Intronic
923556344 1:235003626-235003648 ACTGAGAAGTCCAAGGTCAAGGG + Intergenic
923821557 1:237448833-237448855 ACAAAGAGGTTAAAGGTCATAGG - Intronic
924372240 1:243363145-243363167 ACAAGGAAGCTGCAGGTCATAGG - Intronic
1064350667 10:14573395-14573417 ACTGGGAAGTCCAAGGTCGAGGG - Intronic
1064784609 10:18880161-18880183 ACTAGGAATCTCAAGGACCTGGG - Intergenic
1065206452 10:23361915-23361937 ACTGGGAAGTTCAAGGTTGAGGG - Intergenic
1065854493 10:29818952-29818974 GCTGGGAAGTCCAAGGTCAACGG - Intergenic
1066277402 10:33882276-33882298 GCTGGGAAGTCCAAGGTCAAGGG + Intergenic
1066673421 10:37863241-37863263 ACTGGGAAGTCCAAGATCAAGGG - Intergenic
1067219195 10:44330945-44330967 GCTAGGAAGTCCAAGATCAAGGG + Intergenic
1067535896 10:47109634-47109656 ACTGGGAAGTCCAAGATCAAGGG - Intergenic
1067798410 10:49337969-49337991 GCTAGGAAGTTCAAGATCAAGGG - Intergenic
1067913503 10:50371765-50371787 GCTAGGAAGTTCAATCTCAAGGG + Intronic
1068730469 10:60352497-60352519 ACTTAGAAGTTCAAGTTAATTGG + Intronic
1071279705 10:84089443-84089465 GCTGGGAAGTTCAAAGTCAAAGG - Intergenic
1071668198 10:87581212-87581234 GCTGGGAAGTCCAAGGTCAAGGG + Intergenic
1071800002 10:89048540-89048562 GCTGGGAAGTTCAAGATCAAGGG - Intergenic
1071842007 10:89482372-89482394 ACTAACAAGTTTGAGGTCATGGG + Intronic
1072652158 10:97304117-97304139 GCTGAGAAGTTCAAGGTCAAGGG - Intergenic
1072892624 10:99338138-99338160 ACTTGTAAATTCAAGGTCACTGG - Intronic
1073231828 10:101977874-101977896 ACTAGGAAGTCCAAGTTCTAGGG - Intronic
1073612745 10:104960416-104960438 GCTGGGAAGTCCAAGGTCAAGGG + Intronic
1074098951 10:110338335-110338357 GCTGGGAAGTCCAAGGTCAAGGG - Intergenic
1075057168 10:119227929-119227951 ACGTGGAACTTCAAGGTCAAGGG - Intronic
1076071504 10:127493549-127493571 GCTAAGAAGTCCAAGGTCAAGGG - Intergenic
1077521038 11:3034882-3034904 GCTGGAAAGTTCAAGGTCAAGGG + Intronic
1078593617 11:12667517-12667539 GCTGGGAAGTTCAAGAGCATGGG + Intergenic
1079087189 11:17454846-17454868 ACTAGGATGCTTAAGGTCAAAGG - Intronic
1079139211 11:17796585-17796607 ACTGGGAAGTCCAAGATCACAGG - Intronic
1079330297 11:19527525-19527547 ACTGGAAAGTTGAAGCTCATTGG - Intronic
1079519824 11:21313617-21313639 GCTGGGAAGTCCAAGGTCAAAGG + Intronic
1080659171 11:34282067-34282089 ACTGGGAAGTACAAGATCAAGGG + Intronic
1081691999 11:45085068-45085090 ACTAGGAAGTCCGAGATCAGGGG + Intergenic
1083524740 11:63352171-63352193 GCTGGGAAGTTCAAGATCAAAGG + Intronic
1084082880 11:66840528-66840550 TGGAGGAAGTTCAAGGTCACGGG - Intronic
1085892128 11:80592984-80593006 ACTATCAAGTTCAATGTGATAGG + Intergenic
1086576394 11:88342977-88342999 GCTAGGAAGTTCATGGTCAGGGG + Intergenic
1086776031 11:90833889-90833911 CCTGGGAAGTCCAAGGTCAAAGG - Intergenic
1086783266 11:90933383-90933405 AATAGTAAGTTGAAGCTCATAGG + Intergenic
1089538622 11:119175744-119175766 ACTAGGAAGATAAATGGCATTGG + Intronic
1089942365 11:122431766-122431788 ACTTGGAAGTCCAAGATCAAGGG - Intergenic
1090102805 11:123818710-123818732 ACTAGGAAGTCCAAGAGCATGGG + Intergenic
1092612016 12:10182427-10182449 AGTAAGAAGGTCACGGTCATAGG - Intronic
1092748086 12:11692327-11692349 GCTAGGGAGTCCAAGGTCAAGGG - Intronic
1093763098 12:22932312-22932334 GCTGGGAAGTTCAAGATCAAGGG - Intergenic
1093903728 12:24664686-24664708 GCTAGGAAGTCCAAGATCAAGGG - Intergenic
1095648863 12:44583023-44583045 GCTGGGAAGTCCAAGGTCAAGGG - Intronic
1096516538 12:52158876-52158898 GCTGGGAAGTCCAAGATCATGGG + Intergenic
1096768810 12:53918760-53918782 GCTGGGAAGTCCAAGGTCAAGGG + Intergenic
1096875850 12:54629878-54629900 GCTAGGAAGTCCAAGGTCAAGGG - Intergenic
1097714093 12:62947215-62947237 ACTGGGAAGTCCAAGATCAAGGG + Intergenic
1100123689 12:91397686-91397708 GCTAGGAAGTTCAAGATCGAGGG + Intergenic
1101196521 12:102388742-102388764 GCTAACAAGCTCAAGGTCATAGG + Intergenic
1101874930 12:108591715-108591737 ACCAGGAAGTCCAGGGACATGGG - Exonic
1102041398 12:109803182-109803204 GCCTGGAAGTTCAAGGTCATGGG - Intronic
1102603581 12:114051811-114051833 ACTTGGAAGTCCAAGATCAAGGG + Intergenic
1102969075 12:117151883-117151905 ACCATGATGTTCAAGGTCACTGG + Intronic
1104561150 12:129845966-129845988 AGTAGTAACTTCCAGGTCATTGG + Intronic
1106146244 13:27052441-27052463 GCTGGGAAGTCCAAGGTCAAGGG - Intergenic
1106994085 13:35460856-35460878 ACTGAGAAGTCCAAGGTCAAAGG + Intronic
1108574913 13:51782500-51782522 ACCAGGAATATCAGGGTCATAGG + Intronic
1108897868 13:55357536-55357558 GCTAGGAAGCTTAAGGTCAAAGG - Intergenic
1109279145 13:60336119-60336141 ACAAGGAAATTCAAGGCCCTTGG + Intergenic
1110051274 13:70902720-70902742 ACTGGGAAGTCCAAGATCAAGGG - Intergenic
1110332786 13:74292132-74292154 ACCAGGAAGTTCAAGTACAGTGG - Intergenic
1110959363 13:81601701-81601723 GCTGGGAAGTCCAAGGTCAAAGG - Intergenic
1111521455 13:89410094-89410116 ACTGAGAAGTCCAAGGTCAACGG - Intergenic
1112035913 13:95496561-95496583 GCTGGGAAGTTCACGGTCAAGGG + Intronic
1115917658 14:38334630-38334652 ACTTGGGATTTCGAGGTCATTGG + Intergenic
1115998350 14:39216307-39216329 AAAAGGAACGTCAAGGTCATGGG + Intergenic
1116844891 14:49856025-49856047 ACTAGGAAGTCCAAGATCAAAGG + Intergenic
1116851976 14:49917820-49917842 AGTAGGAAATTCCAGGTAATGGG + Intergenic
1120683732 14:87512899-87512921 ACTAAGAAGTCCAAGGCCAAGGG + Intergenic
1120887383 14:89462531-89462553 ACTGGAAAGTCCAAGGTCAATGG + Intronic
1121899611 14:97681909-97681931 AGTAGCAAGTTCAAGGTTACTGG + Intergenic
1124555549 15:30721832-30721854 ACTATGAAGTCCAAGTTTATAGG - Intronic
1124675713 15:31683863-31683885 ACTATGAAGTCCAAGTTTATAGG + Intronic
1125909687 15:43425118-43425140 GCTGGGAAGTCCAAGGTCAAGGG - Intronic
1127521092 15:59743666-59743688 ACTGGGAAGTCCAAGATCAAGGG - Intergenic
1128206080 15:65853304-65853326 GCTGGGAAGTTCAAGATCAAGGG + Intronic
1128808436 15:70552387-70552409 GCTGGGAAGTCCAAGGTCAAGGG + Intergenic
1129611864 15:77066885-77066907 GCTGAGAAGTTCAAGGTCAAGGG + Intronic
1135754352 16:25083899-25083921 GCTGGGAAGTCCAAGGTCAAGGG - Intergenic
1137496031 16:48970101-48970123 GCTGGGAAGTTCAAGATCAAGGG - Intergenic
1138646138 16:58426421-58426443 ACTAGGAAGTTCCAGGGACTTGG + Intergenic
1139523299 16:67497617-67497639 AAAATGGAGTTCAAGGTCATAGG + Intergenic
1140997194 16:80272445-80272467 AATGGGAAGTACATGGTCATTGG - Intergenic
1141782665 16:86174246-86174268 ACTAGGAAGTTCAAAAACTTAGG + Intergenic
1142541801 17:665368-665390 GCTGGGAAGTCCAAGGTCAAGGG - Intronic
1143695320 17:8610756-8610778 GCTGGGAAGTCCAAGGTCAAGGG - Intronic
1146530000 17:33600341-33600363 GCTAGGAAGTCCAATGTCAAAGG - Intronic
1146548526 17:33759978-33760000 GCTGGGAAGTCCAAGGTCAAGGG - Intronic
1147437708 17:40427772-40427794 ACTGGGAAGTCCAAGATCAAGGG - Intergenic
1147473914 17:40691317-40691339 ACTAGGATGTTCGAAGCCATAGG - Intergenic
1147504884 17:41006094-41006116 AGTAGTAAGTTTTAGGTCATTGG + Intergenic
1151127636 17:71862153-71862175 GCTGGGAAGTCCAAGGTCAGGGG - Intergenic
1151835427 17:76579830-76579852 GCTGGGAAGTCCCAGGTCATAGG - Intronic
1153185079 18:2477460-2477482 GCTGGGAAGTTCAAGGTTAAGGG + Intergenic
1154998536 18:21664737-21664759 ACTTGGGAGTTTAAGGTCAGAGG - Intronic
1155445295 18:25905324-25905346 GCCAGGAAGTCCAAGGTCAGTGG + Intergenic
1157371561 18:47117517-47117539 GCTAGGAAGTTCAAGGTTGAAGG - Intronic
1158748840 18:60235053-60235075 GCTAGGAAGTCCAAGATCAAGGG + Intergenic
1158770726 18:60513979-60514001 AGTAAGAAGTTCAAGGTAAGTGG - Intergenic
1158902859 18:61982593-61982615 ACTGGGAAGTTCAAGGGCTCTGG + Intergenic
1163805788 19:19396449-19396471 ACTAGGAACTTCCAGATCACTGG - Intronic
1165986397 19:39772804-39772826 GCTGGGAAGTACAAGGTCAAGGG + Intergenic
925365758 2:3310998-3311020 AATAGGAAGTTCAGAGACATTGG - Intronic
925922931 2:8649173-8649195 AATAGGAAGTTAAATGTTATGGG - Intergenic
926402369 2:12510972-12510994 GCTGGGAAGTTCAAGGTCAAGGG - Intergenic
926556603 2:14364970-14364992 ACTAGGAAGCTCAAAAACATTGG - Intergenic
927427545 2:22997448-22997470 GCTGGGAAGTCCAAGGTCAAGGG - Intergenic
928157535 2:28890336-28890358 ACTGGGAAGATCAGGGTCATTGG - Intergenic
928399040 2:30964850-30964872 AGTGGGAAGTTCCAGGTGATGGG - Intronic
928822650 2:35380394-35380416 GCTAGGAAGTCCAAGATCAAGGG - Intergenic
930626097 2:53699068-53699090 ACTGGGAAGTCCAAAGTCAAGGG + Intronic
930861205 2:56075190-56075212 ACTAGGAAGTTCAAGTACCTTGG - Intergenic
931945810 2:67306076-67306098 ACTGGGAAGTCCAAGATCAAGGG + Intergenic
932460300 2:71877896-71877918 GCTAGGAAGTCCAAGAGCATTGG - Intergenic
936001815 2:108839725-108839747 ACTAGTAAGCTCAGGGTCACAGG - Intronic
937488472 2:122340562-122340584 ACTAAGAAGCTCAAGGTCCAGGG - Intergenic
939235873 2:139492122-139492144 ACAATAAAATTCAAGGTCATTGG - Intergenic
939935495 2:148287639-148287661 ACTGGGAAGTCCAAGGTCAAGGG + Intronic
940155221 2:150649055-150649077 GCTAGGAAGTCCAAGGTCAAAGG + Intergenic
940982658 2:160020737-160020759 GCTGGGAAGTTCAAGGTCAAAGG - Intronic
941590539 2:167415372-167415394 GCTAAGAAGTACAAGGTCAAGGG - Intergenic
941744636 2:169073870-169073892 ACTAGGAAGTTCTAGAACAGTGG + Intronic
941866166 2:170336968-170336990 ACCATGAAGTTGAAGGTCAGGGG + Intronic
942855662 2:180544045-180544067 ACTAGGAAGTCCAAGATCTAGGG - Intergenic
943051038 2:182913572-182913594 GCTGGGAAGTACAAGGTCAAGGG - Intronic
943467182 2:188242140-188242162 ACCGGGAAGTTCAAGATCACAGG - Intergenic
944059377 2:195556135-195556157 ACTAGAGAGTTCAAGGCCATAGG + Intergenic
944409546 2:199425502-199425524 AGTAGAAAATTCAAGGTCAGAGG + Intronic
946659128 2:221980462-221980484 ACTAACAATTTCATGGTCATAGG + Intergenic
948793144 2:240389353-240389375 ACTAGGCAGCTCCAGGTCAGGGG - Intergenic
1169852556 20:10068459-10068481 ACTGGGAAGTCCAAGGTCAAGGG + Intergenic
1171471704 20:25377436-25377458 GCTGGGAAGTCCAAGGTCAAGGG + Intronic
1173438735 20:43056457-43056479 ACAGGGAAGTTTAAGATCATAGG + Intronic
1173584240 20:44169965-44169987 GCTAGGCAGTCCAAGGTCAAGGG - Intronic
1174921579 20:54708596-54708618 GCTGGGAAGTCCAAGGTCAAGGG + Intergenic
1176251214 20:64121031-64121053 GCTGGGAAGTCCAAGGTCAATGG - Intergenic
1177338462 21:19763877-19763899 GCTGGGAAGTTCAAGACCATGGG - Intergenic
1178462138 21:32811981-32812003 ACTGGGAATTCCAAGGTCAAGGG - Intronic
1178834962 21:36089104-36089126 GCTGGGAAGTACAAGGTCAAAGG - Intergenic
1179022408 21:37652173-37652195 ACCAGGAAGCTTCAGGTCATAGG + Intronic
1179157798 21:38864993-38865015 GCTTGGAAGTCCAAGGTCAAGGG - Intergenic
1179559992 21:42209595-42209617 ACAAGGAAGTTAAAAGTCAGAGG - Intronic
1182538222 22:31022201-31022223 ACTGGGAAGTCCAAGGTCAAAGG + Intergenic
1182826914 22:33273601-33273623 AGTAGGGAGTTCAAAGTCACGGG + Exonic
1182907094 22:33947967-33947989 ATTGGGAAGTTCAAGGCCATGGG - Intergenic
1182951025 22:34375988-34376010 GCTGGGAAGTCCAAGGTCAAGGG + Intergenic
1183396899 22:37576835-37576857 ACTCGGAAGTCCAGGGTCAGGGG + Intronic
1184319038 22:43725015-43725037 GCTAGAAAGTCCAAGGTCAAGGG + Intronic
1184690696 22:46116021-46116043 CCTAGGAAGGCCAAGGTCAGCGG - Intergenic
950319547 3:12037466-12037488 GCTAGGAAGTCCAAGATCAAGGG + Intronic
950472218 3:13193385-13193407 ACTAGGAAGGTAAAGATCAGAGG + Intergenic
950741604 3:15056654-15056676 TCTAGGAAATGCAAGGACATGGG + Intronic
951909718 3:27737221-27737243 GCTAGGAAGTCCAAGGTCAAGGG + Intergenic
951914003 3:27780514-27780536 GCTGGGAAGTTCAAGATCAAGGG - Intergenic
952117924 3:30205082-30205104 ACTGGGAATTTAAAGGTAATGGG - Intergenic
953000643 3:38929893-38929915 ACTGGGAAGTCCAAGATCAAAGG - Intronic
953144359 3:40260796-40260818 ACTGGGAAGTCTAAGGTCAAAGG + Intergenic
953211280 3:40877467-40877489 AGTAGGAAGTTCAAGTGCAATGG + Intergenic
954934864 3:54317416-54317438 GCTAGGAAGTCCAAGGTCAAGGG + Intronic
955506455 3:59637988-59638010 ACTGGGAAGTTCAAGATCAAGGG + Intergenic
956237530 3:67090859-67090881 GCTGGGAAGTTCAGGGTCAAGGG - Intergenic
956255961 3:67283579-67283601 GCTGGGAAATTCAAGGTCAAGGG + Intergenic
957669044 3:83276867-83276889 ATTGGGAAGTACAAGATCATGGG - Intergenic
957790228 3:84931269-84931291 ACTGGGAAGTTCAAGATCAAGGG + Intergenic
958268893 3:91473541-91473563 ACTGAGAAGTCCCAGGTCATGGG - Intergenic
958456378 3:94336863-94336885 ACTGGGAAGTCCAAGATCAAGGG + Intergenic
959133868 3:102392374-102392396 GCTAGGAAGTCCAAGGTCAAGGG + Intronic
959223531 3:103552896-103552918 GCTGGGAAGTTCAAGATCAAGGG + Intergenic
960006399 3:112785602-112785624 GCTGGGAAGTCCAAGGTCTTGGG - Intronic
960480212 3:118179025-118179047 ACTGGGAGGCCCAAGGTCATGGG + Intergenic
960610580 3:119551577-119551599 GCTGGGAAGTCCAAGGTCAAGGG - Intronic
962925290 3:139987716-139987738 TCTAGGAAGATCAAGGACATGGG - Intronic
963053550 3:141163482-141163504 ACTGGGAAGTCCAAGGTCAAGGG - Intergenic
963987728 3:151616870-151616892 ACTGGGAAGTTCAAGGTTGAGGG + Intergenic
964015865 3:151945680-151945702 ACTGGGAAGTCCAAGATCAAGGG - Intergenic
964180940 3:153884809-153884831 ACTAGGAAGTCCAAGGTTGAGGG - Intergenic
965461317 3:168967819-168967841 CCTAGGAAGTTCAAGGTCAAGGG + Intergenic
966043270 3:175518546-175518568 GCTGAGAAGTCCAAGGTCATAGG + Intronic
966200428 3:177355770-177355792 GCTAGGAAGTCCAAGGTCACAGG - Intergenic
966282898 3:178255309-178255331 GCTGGGAAGTTCAAGATCAAAGG - Intergenic
966306974 3:178547227-178547249 GCTGGGAAGTTCAAGGTCAAGGG - Intronic
966393225 3:179474969-179474991 GCTGGGAAGTTCAAGGTCGAGGG + Intergenic
966708634 3:182947167-182947189 CCTAAGAAGTTCAAGGGTATGGG + Intronic
966716064 3:183013953-183013975 TCTGGGAAGTTCAAGATCAAGGG + Intergenic
967424445 3:189310204-189310226 AATAGGAAATTCAAGGTGTTTGG - Intronic
967594383 3:191312958-191312980 TATGGGCAGTTCAAGGTCATAGG + Intronic
967774751 3:193374984-193375006 GCTGGGAAGTTCAAGGTCAAGGG - Intronic
967920086 3:194608065-194608087 ACTGGGAAGTTCTACATCATGGG - Intronic
968670949 4:1851263-1851285 GCTTGGAGGTTCAAGGTCACTGG - Intronic
969999672 4:11352394-11352416 GCCAGGAAGTCCAAGGTCAAAGG + Intergenic
970002396 4:11376912-11376934 AATAGGAAGTTCAAGGGATTTGG - Intergenic
970189032 4:13492878-13492900 GCTGGGAAGTCCAAGGTCAAAGG + Intergenic
970197081 4:13561823-13561845 GCTGGGAAGTTCAAGATCAAAGG + Intergenic
972449168 4:39179986-39180008 ACTGAGAAGTCCAAGGTCAAGGG - Intergenic
972688911 4:41377681-41377703 ACTGGGAAGTCCAAGGTTAAGGG + Intronic
972907563 4:43769409-43769431 GCTGGGAAGTTCAAGGTCAAGGG + Intergenic
973592670 4:52458498-52458520 CCTAGGAAGTGCAAGGGGATGGG - Intergenic
973970059 4:56204369-56204391 GCTGGGAAGTTCGAGGTCAAGGG + Intronic
974095774 4:57362213-57362235 GCTGGGAAGTTCAAGGTCAAGGG + Intergenic
974390804 4:61264892-61264914 GCTAAGAAGGCCAAGGTCATAGG + Intronic
974438758 4:61890426-61890448 GCTGAGAAGTTCAAGGTCAAGGG + Intronic
974467888 4:62280763-62280785 GCTAAGAAGTCCAAGGTCAAGGG - Intergenic
975484970 4:74925896-74925918 ACTAGGAGCTTCCAGGTCATAGG + Intergenic
975647737 4:76562109-76562131 CAAAGGAAGTTCAAGGTCAATGG - Intronic
975795723 4:78005387-78005409 ACTAGAAAGATTAAGGTCTTTGG + Intergenic
976446452 4:85135497-85135519 GCTGGGAAGTTCAAGATCAAGGG + Intergenic
977228350 4:94421525-94421547 ACTGGGAAGTCCAAGATCAAGGG - Intergenic
978184688 4:105843501-105843523 GCTAGGAAGTCCAAGATCAAGGG + Intronic
978836963 4:113162503-113162525 AATAGCAAGTGCAATGTCATAGG - Intronic
979319191 4:119302633-119302655 AGTAGAAAGTTCAAGGTGGTTGG - Intronic
981874644 4:149527521-149527543 ACTGGGAAGTTCAAGATCAAGGG - Intergenic
982170210 4:152654755-152654777 GCTGGGAAGTTCAAGATCAAAGG - Intronic
984425629 4:179581578-179581600 GCTGGGAAGTTCAAAGTCAAGGG + Intergenic
984510825 4:180676719-180676741 GCTAAGAAGTCCAAGGTCAAGGG + Intergenic
984838635 4:184047523-184047545 ACAAGTAATTTGAAGGTCATGGG + Intergenic
986183027 5:5411252-5411274 ACTTGGAAGTTCAAGGTTTAGGG - Intergenic
986727777 5:10612279-10612301 GCTGGGAAGTCCAAGATCATGGG + Intronic
986748930 5:10767743-10767765 GCTGGGAAGTCCAAGGTCAAGGG - Intergenic
986788948 5:11142072-11142094 GCTGGGAAGTACAAGGTCAGGGG - Intronic
986970295 5:13326710-13326732 GCTGGGAAGGTCAAGGTCAGGGG - Intergenic
987154619 5:15076671-15076693 ACTAGGAAGTCCAAGGTCAAGGG - Intergenic
988937904 5:36107627-36107649 CCTACTAAGTACAAGGTCATAGG - Intronic
989348656 5:40458660-40458682 GCTCGAAAGTTCAAGGTCAGGGG - Intergenic
990424685 5:55674583-55674605 ACTGGGAAGTCCAAGGTCAAAGG - Intronic
992852802 5:80828145-80828167 ACTGGGAAGTCCGAGGTCAAGGG + Intronic
993136322 5:83970041-83970063 ACTGGGAAGTTAGAGGGCATGGG - Intronic
993474902 5:88352429-88352451 TACAGGAAGTTCAAGGTCATTGG + Intergenic
994926598 5:106123849-106123871 GCTAGGAAGTTCAATATCAAGGG + Intergenic
996490739 5:124092784-124092806 ACTGGGAAGTCCAAGATCAGGGG + Intergenic
997421584 5:133772568-133772590 GCTGGGAAGTTCAAGTTCAAGGG + Intergenic
998429808 5:142061085-142061107 TCTGGGAAGTCCAAGGTCAAGGG - Intergenic
998580431 5:143368837-143368859 GCTGGGAAGTCCAAGGTCAAGGG + Intronic
999912631 5:156221198-156221220 ACTGGGAAGTCCAAGATCATGGG + Intronic
1000089385 5:157917090-157917112 GCTGGGAAGTCCAAGGTCAAGGG - Intergenic
1000331542 5:160209651-160209673 ACTGGGAAGTCCAAGGTCTAGGG - Intronic
1001121281 5:168982433-168982455 GCTGGGAAGTCCAAGGTCAAGGG - Intronic
1001867038 5:175114777-175114799 ACTAGGAATTCCTCGGTCATGGG + Intergenic
1003340170 6:5213142-5213164 ACTCAGAAGTTCAAGGACATGGG - Intronic
1003945293 6:11070038-11070060 GCTAGGGAGTTTAAGGTCAAGGG + Intergenic
1005564421 6:27075957-27075979 GCTGGGAAGTCCAAGGTCATGGG - Intergenic
1005912090 6:30319366-30319388 GCTGGGAAGTCCAAGGTCAAGGG - Intergenic
1006852926 6:37112458-37112480 GCTGGGAAGTCCAAGGTCAAGGG + Intergenic
1007492124 6:42231272-42231294 GCTGGGAAGTTCAAGGTCAAGGG - Intronic
1009174299 6:60440758-60440780 ACTGAGAAGTCCCAGGTCATGGG + Intergenic
1009967402 6:70592103-70592125 GCTAGAAAGTCCAAGGTCAAGGG - Intergenic
1011190948 6:84727634-84727656 GCTGAGAAGTTCAAGGTCAAGGG - Intronic
1012727365 6:102831523-102831545 ACTGGGAAGTCCAAGAGCATAGG - Intergenic
1013525089 6:110966556-110966578 ACCAGGAAGGTGAAGATCATTGG + Intronic
1013597990 6:111678293-111678315 ACATGGAAGTTCTAGGACATGGG - Intronic
1014498634 6:122158542-122158564 ACTTGGAAGTTCAAACTCATTGG + Intergenic
1014597406 6:123361733-123361755 AATAGGAAGGTGATGGTCATGGG - Intronic
1015116202 6:129652030-129652052 ACTGGAAAGTTCAAGATCAAAGG - Intronic
1015137964 6:129895107-129895129 ACTAGGAAGTTCACGGTCAAGGG - Intergenic
1015441176 6:133248514-133248536 ATTAGGGAGTTCAAAGTCAGAGG - Intronic
1015537256 6:134279129-134279151 ACTCAGAAGTTCAAGGTTACTGG + Intronic
1015641182 6:135334423-135334445 ACTGGGAAGTCCAAGCTCAAGGG - Intronic
1015935045 6:138400758-138400780 GTTGGGAAGTTCAAGGTCAAGGG + Intergenic
1016920675 6:149289915-149289937 AGCAGGGAGTTCCAGGTCATAGG + Intronic
1017029446 6:150207888-150207910 CCTGGGAAGTTCAAGGTCGAGGG + Intronic
1017574396 6:155786198-155786220 GCTGGAAAGTTCAAGGTCAAGGG - Intergenic
1017637126 6:156454525-156454547 AATAGGAAATTCAAGGGCACGGG - Intergenic
1018003995 6:159603384-159603406 ACTGGGAAGTCCAAGATCAAGGG + Intergenic
1018016171 6:159714309-159714331 TCAGGGAAGTCCAAGGTCATTGG - Intronic
1018949802 6:168371839-168371861 CCAAGGAAGTTCATGTTCATAGG + Intergenic
1022383614 7:29883262-29883284 ACTGTGAGGTTCAAGGTCATTGG + Intronic
1022551170 7:31240457-31240479 ACTAGGAAGTTCAATTTGAATGG + Intergenic
1022720197 7:32935820-32935842 GCTAGAAAGTCCAAGGTCAAGGG + Intergenic
1023370494 7:39508209-39508231 GCTAGGAGGTCCAAGGTCAAGGG + Intergenic
1023736005 7:43236555-43236577 AGCAGGAACTTCCAGGTCATAGG + Intronic
1024376742 7:48648127-48648149 ACTAGGTGGCTTAAGGTCATAGG + Intergenic
1026115433 7:67491831-67491853 GCTGGGAAGTTCAAGTTCAGTGG - Intergenic
1026241092 7:68575820-68575842 ACTGAGAAGTCCAAGGTCAAGGG + Intergenic
1026407304 7:70079857-70079879 ACTGGGAAGTTCAAGATCAAGGG + Intronic
1026507187 7:70994943-70994965 GCTGGGAAGTCCAAGGTCAAGGG + Intergenic
1026898590 7:74024829-74024851 ACTAGTAAATTTAAGATCATAGG + Intergenic
1026984245 7:74544994-74545016 ACCAGGAAGTTCCTGGTCAAAGG + Intronic
1029032740 7:97486030-97486052 GCTAAGAAGTCCAAGGTCAAAGG + Intergenic
1030338564 7:108351264-108351286 CCTAGGAAGTCCAAGGTCAAGGG - Intronic
1030362800 7:108612462-108612484 GCTTGGAAGTCCAAGGTCAAGGG + Intergenic
1030534717 7:110751888-110751910 ACTCGGAAGTTAAAGGTTTTGGG - Intronic
1031226132 7:119040521-119040543 GCTGGGAAGTTCAAGGTCAATGG - Intergenic
1032823447 7:135545969-135545991 GCTGGGAAGTTCAAGATCAAGGG + Intergenic
1032945093 7:136841890-136841912 ACTAATGAGTTCAAGGTCATGGG + Intergenic
1033376768 7:140768956-140768978 GCTGGGAAGTCCAAGGGCATTGG - Intronic
1033559567 7:142518723-142518745 ACTGGGAAGTCCAAGATCAATGG - Intergenic
1037020451 8:13963920-13963942 ACTAGGAAATCTAAGGTCTTAGG - Intergenic
1037199175 8:16229718-16229740 TCTAGAAAGTTCAAGATCAAGGG - Intronic
1037415246 8:18643113-18643135 ACTGGGAAGTCCAAAGTCAAGGG + Intronic
1039521055 8:38172141-38172163 AATGTGAAGTTCAAGTTCATTGG + Intronic
1041153979 8:54964542-54964564 GCTGGGAAGTCCAAGGTCAATGG - Intergenic
1042624927 8:70747580-70747602 GCTGGGAAGTCCAAGGTCAAGGG - Intronic
1045115930 8:98979711-98979733 GCTGGGAAGTCCAAGGTCAAGGG + Intergenic
1045494829 8:102699560-102699582 GCTGGGAAGTCCAAGGTCAAAGG + Intergenic
1046211933 8:111087571-111087593 GCTGGGAAGTCCAAGGTCAAGGG + Intergenic
1047844773 8:128794032-128794054 GCTGGGAAGTCCAAGGTCAAGGG - Intergenic
1048601925 8:135927701-135927723 ACTGGGAAGTCTAAGGTCAAGGG - Intergenic
1048841675 8:138572288-138572310 CCTGGGAAGTTCAAGATAATGGG + Intergenic
1049154295 8:141057362-141057384 GCGAGCAAGTTCAAAGTCATTGG + Intergenic
1049710764 8:144062361-144062383 ACTAGGAGGTCCATGGGCATGGG - Intronic
1050166299 9:2768494-2768516 GCTGGGAAGTCCAAGGTCAAGGG + Intronic
1050664896 9:7924770-7924792 GCTGGGAAGTCCAAGGTCAAGGG + Intergenic
1051251212 9:15160905-15160927 GCTGGGAAGTCCAAGGTCAAGGG + Intergenic
1051668070 9:19484001-19484023 GCTGGGAAGTCCAAGGTCAAGGG - Intergenic
1051719870 9:20025689-20025711 ACTTGGTCGTTCCAGGTCATTGG - Intergenic
1052181776 9:25537666-25537688 ATCAGGAATATCAAGGTCATTGG - Intergenic
1053825653 9:42021775-42021797 ACATGGAAGTTCAATGTCCTAGG + Intronic
1054604909 9:67165583-67165605 ACATGGAAGTTCAATGTCCTAGG - Intergenic
1055450135 9:76423448-76423470 ACTAGGAAGTTCAAGGTCATGGG - Intronic
1055507304 9:76961499-76961521 GCTGGGAAGTTCAAGATCAAGGG - Intergenic
1055843909 9:80537755-80537777 ACTTGGGAGTTCAAGGTCAAGGG - Intergenic
1059182902 9:112236413-112236435 ACAAGCAAGCTCAAGATCATAGG + Intronic
1059857633 9:118417703-118417725 GCCAGGAAGTCCAAGGTCAAGGG - Intergenic
1060119595 9:120975714-120975736 CCTAGGAAGTCCAAGATCAGGGG - Intronic
1060331996 9:122681280-122681302 ACTGGGAAGTCCAAAGTCAAGGG + Intergenic
1185759856 X:2682168-2682190 ACTGGGAAGTCCAAGATCAAGGG + Intergenic
1186021192 X:5257326-5257348 TCAAGGATTTTCAAGGTCATGGG - Intergenic
1186399854 X:9247574-9247596 ACTAAGAAGTTCAAGGTTGCAGG - Intergenic
1186715403 X:12245870-12245892 GCTAGGAAGTCCAAGGTCCAGGG - Intronic
1188819764 X:34760594-34760616 GCTGGGAAGTCCAAGGTCAAGGG - Intergenic
1188979595 X:36715035-36715057 ACCAGGAGGTTCAAGGTGAGAGG + Intergenic
1189111212 X:38291800-38291822 ACCAGGACGTTGTAGGTCATTGG - Intronic
1189523945 X:41800134-41800156 CCTAGGAAGTTGAAGGAGATGGG - Intronic
1190527754 X:51345201-51345223 GCTGAGAAGTTCAAGGTCAAGGG - Intergenic
1191225549 X:58039071-58039093 ACTGAGAAGTTCAAGGTCAAGGG - Intergenic
1192483973 X:71509141-71509163 ACTAGGAAGTGGCAAGTCATGGG + Intronic
1192591292 X:72361953-72361975 AATGGGAAGTTCAAAGTCATTGG - Intronic
1192941770 X:75920363-75920385 AGTAGGAAGGTCAGGGACATGGG - Intergenic
1194050132 X:89057886-89057908 ACTGGTAAGGACAAGGTCATTGG + Intergenic
1194196878 X:90904954-90904976 CCTTGGAATTTCAAGGTCAAGGG + Intergenic
1195463362 X:105152895-105152917 AGTAGGAAATTCAAGATCAAGGG - Intronic
1195769519 X:108335195-108335217 GCAAGGAAGGTCAAAGTCATGGG + Intronic
1195848617 X:109257046-109257068 GTTAGGAAGTTCAAGGTCAAGGG - Intergenic
1196054392 X:111339514-111339536 GCTGTGAAGTTCAAGGTCAAGGG - Intronic
1197620707 X:128744216-128744238 ACTAGGAAGTCCGAGGTCAAGGG - Intergenic
1197861200 X:130972459-130972481 GCTAGGAAGTCCAAGATCATGGG - Intergenic
1198979568 X:142379715-142379737 GCTGGAAAGTTCAAGATCATGGG - Intergenic
1199103323 X:143832674-143832696 AACAGGAAATTCTAGGTCATAGG - Intergenic
1199938844 X:152604456-152604478 ACTGGGAAGTCCAAGATCAAGGG + Intergenic
1200542727 Y:4479160-4479182 CCTTGGAATTTCAAGGTCAAGGG + Intergenic
1201255637 Y:12105844-12105866 AGTGGGAACTTCCAGGTCATGGG - Intergenic