ID: 1055454351

View in Genome Browser
Species Human (GRCh38)
Location 9:76459156-76459178
Sequence CTCTGGGGGCGGCCCCGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 384}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055454342_1055454351 -7 Left 1055454342 9:76459140-76459162 CCTAGAAAGGCGGGGCCTCTGGG 0: 1
1: 0
2: 1
3: 25
4: 205
Right 1055454351 9:76459156-76459178 CTCTGGGGGCGGCCCCGGGGCGG 0: 1
1: 0
2: 1
3: 39
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055454351 Original CRISPR CTCTGGGGGCGGCCCCGGGG CGG Intronic
900137916 1:1126263-1126285 CTCCCGGGGCGGCACCGGCGTGG + Intergenic
900241873 1:1621162-1621184 CTCTGAGGGCAGCCCCCAGGTGG - Intronic
900342288 1:2194811-2194833 GTCTGGAGGCGGGGCCGGGGCGG - Intronic
900382496 1:2391809-2391831 CCCTGGAGGCGGCGCCGCGGAGG + Intronic
900427341 1:2586689-2586711 TCTTGGGGGCGGGCCCGGGGCGG + Intronic
900464969 1:2821129-2821151 GGCTGGGGGCGGCACCAGGGTGG + Intergenic
901051664 1:6428605-6428627 CTCTGGGGGCAGCCCCAGAAGGG - Intronic
901168144 1:7234422-7234444 CTCTGGGGCCTGCCCAGGGCGGG + Intronic
901381776 1:8878992-8879014 CTCCGGGGGATGGCCCGGGGCGG + Intronic
902482659 1:16719756-16719778 CTCTGGGGGCAGCCCCAGAAGGG + Intergenic
902919359 1:19657084-19657106 CTGTGTGGGGGGCCCCAGGGGGG - Exonic
903065440 1:20696873-20696895 CTCTGGGGAGGCTCCCGGGGAGG - Intronic
903886092 1:26541998-26542020 CTCTGGTGGCGGGCGGGGGGAGG - Intronic
904500204 1:30908795-30908817 CGCTGGGGGCGGCCCGGCGGCGG - Intergenic
905032904 1:34899709-34899731 CTCCGGGGGTGGATCCGGGGTGG + Exonic
905151449 1:35931085-35931107 CTTCCGGGGCGGCCCCGGGCAGG + Exonic
905169390 1:36100140-36100162 CTCTGGTGGCGGGGCCGGTGGGG - Exonic
905789867 1:40784132-40784154 CGCGGGGGGCGTCCCCGGGCGGG - Exonic
906039431 1:42776547-42776569 ATCGGGGGGCGGCCCGGGGAGGG - Intronic
906140478 1:43531178-43531200 AGCTGGGGGCGGTCCCGGGGGGG + Intronic
906322063 1:44823069-44823091 CTCTGGCGGCGGGCCCAGGATGG + Exonic
906467425 1:46095491-46095513 CTCTGGGGCCTGTCGCGGGGTGG + Intronic
907442923 1:54489573-54489595 CTCCGGCGGCGGCCCCTAGGGGG - Intergenic
907491235 1:54810195-54810217 CTCTGTGGAAGGCACCGGGGTGG - Intronic
913144514 1:115976485-115976507 CGCTGGCGGCGGGGCCGGGGCGG - Exonic
914834903 1:151198853-151198875 GTCTGAGGGAGGCCCCGGAGGGG + Exonic
915070334 1:153261126-153261148 CTCTGGCGGCGGCTGCGGCGGGG + Exonic
915246281 1:154558454-154558476 GGCCGGGGGCGGCCCAGGGGGGG - Exonic
915302862 1:154961550-154961572 CGGTGGGGGCGGCGCCGAGGCGG + Exonic
915326843 1:155085166-155085188 CTCGGGGGTGGGCCCCGGGGCGG + Exonic
915469164 1:156115400-156115422 CGCTGGGGGCAGTTCCGGGGAGG - Intronic
915552246 1:156642035-156642057 GGGCGGGGGCGGCCCCGGGGAGG + Exonic
916582883 1:166124081-166124103 CTATGGTGGCAGCCTCGGGGTGG - Intronic
918001542 1:180502185-180502207 CTCAGGGGACGACTCCGGGGAGG - Exonic
920522213 1:206635910-206635932 AGGTGGGGGCGGTCCCGGGGAGG - Intronic
922481221 1:225941091-225941113 CTCTGGGTGCTGCCCCTGGCTGG - Exonic
922746873 1:228049102-228049124 CACTGGGGCTGGCCCTGGGGAGG + Intronic
923051110 1:230392205-230392227 CTCTCAGGGCAGCCCCGGTGTGG - Intronic
923372454 1:233327632-233327654 GCCTAGGGGCGGGCCCGGGGGGG + Intergenic
923783021 1:237042487-237042509 CTCGGGAGCCGGCCCCGGCGAGG + Exonic
924473437 1:244363554-244363576 CTCTGGGTGGGGCCCCCAGGAGG + Intronic
924501935 1:244646017-244646039 GACTGGGAGAGGCCCCGGGGTGG - Intergenic
1063377564 10:5563306-5563328 CTGGGGGGGCAGCCCTGGGGTGG - Intergenic
1067068522 10:43116758-43116780 CCCTGGGGGAGTCTCCGGGGCGG + Intronic
1067295779 10:44974586-44974608 CTCTGGGAGCGCGCCCCGGGTGG - Intronic
1067346776 10:45443389-45443411 CTCAGGGGGCGCAGCCGGGGTGG - Intronic
1067796710 10:49326498-49326520 CGGTGGGGGCGGCTCTGGGGAGG - Exonic
1070032615 10:72692193-72692215 CTCTCGGGGCGGCGGCGGCGGGG + Exonic
1070198104 10:74177195-74177217 CCCCGGGGGCGGCCCAGGGCCGG + Intronic
1071497642 10:86179818-86179840 CTCTGGAGGATGCCCTGGGGAGG - Intronic
1072491189 10:95907615-95907637 CTGAGCGGGCGTCCCCGGGGAGG - Intronic
1072692052 10:97578364-97578386 CTCTGGGGGCGGCTCATGCGAGG - Exonic
1073642708 10:105269300-105269322 TTCTGGGAGAGGCCCCAGGGAGG - Intergenic
1075533645 10:123252298-123252320 CTCTGGGTGAGGTCCTGGGGTGG - Intergenic
1076563378 10:131381830-131381852 CTCTGGGGTGGGCCCTGGGGAGG - Intergenic
1076664502 10:132078610-132078632 CTCTGGGGGCGGGGGGGGGGGGG + Intergenic
1076707091 10:132307982-132308004 CGCTGGGGGCGGGGCAGGGGCGG + Intronic
1076792514 10:132784857-132784879 ATCCGGGGGCGGCCCCGGGTGGG - Exonic
1076805784 10:132858272-132858294 TGCTGGGGGCGGCCCCAGGTTGG + Intronic
1076821192 10:132940540-132940562 CCCTGGGGGTGCGCCCGGGGAGG + Intronic
1077112411 11:867714-867736 CTCAGGAGGAGCCCCCGGGGTGG - Intergenic
1077453970 11:2666963-2666985 CTCTGGGGGCCCGCCCGGGAGGG + Intronic
1077468841 11:2747385-2747407 GCCTGGGGGTGGCCCCGGGAGGG + Intronic
1077489755 11:2855351-2855373 CTCTGGGGTCGGCCCAGGCCAGG - Intergenic
1077582090 11:3423153-3423175 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
1078142715 11:8703443-8703465 CTCTGGGGGAGTCACAGGGGTGG + Intronic
1079135759 11:17775290-17775312 CACTGGGGGCTGGCCTGGGGGGG - Intronic
1080457014 11:32427430-32427452 CTCTGGGGTGGGCCCCCGGCCGG - Intronic
1080727951 11:34916386-34916408 CGCTGAGGGCAGCCCGGGGGCGG + Exonic
1081659360 11:44878408-44878430 GTCTGGGGCCAGCCCGGGGGAGG + Intronic
1081807873 11:45900094-45900116 GTCAGGGGGCGGGGCCGGGGCGG - Intronic
1081807900 11:45900158-45900180 CTCTGCGGGCGGCGGCGGCGCGG + Exonic
1082003700 11:47408537-47408559 CGCCGGGGGCGGCCCCGGGCCGG + Intronic
1083952395 11:65964180-65964202 CTCTGGGGCCAGCACGGGGGAGG + Intronic
1084105014 11:66975429-66975451 CCCTGGGGGAGGCCCCAGGAGGG + Exonic
1084239008 11:67805970-67805992 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
1084412651 11:69013369-69013391 CTCTGGGGGGGGCTCCTGAGCGG - Exonic
1084589032 11:70079455-70079477 CTCTGGGTCTGGCCCTGGGGAGG - Intronic
1084833424 11:71786870-71786892 CTCAGGAGGCGGGCCCTGGGAGG - Intergenic
1085123616 11:73982877-73982899 CTCGGGGGCGGGGCCCGGGGTGG + Exonic
1089139543 11:116274830-116274852 CTCTGGGGGTGGGCAGGGGGTGG + Intergenic
1090653253 11:128824693-128824715 CTCAGGGGGCAGCTCCGGGTGGG + Intergenic
1091921372 12:4307696-4307718 CTCTGGGGGCCTCCCCGTGCTGG + Intergenic
1092194081 12:6538652-6538674 TTCTGTGGGCAGCCCCAGGGAGG + Intronic
1092409696 12:8243599-8243621 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
1094703935 12:32896839-32896861 CGCGGGGGGCGGGCCAGGGGCGG - Intronic
1095949276 12:47773168-47773190 CGCTGGGGGCGGGCCGGGGGCGG + Intronic
1096244117 12:49974835-49974857 CTCTGCTGGCAGCCCTGGGGAGG + Intronic
1096466229 12:51848791-51848813 CCCTGGGGGCGGGCGAGGGGAGG - Intergenic
1097169062 12:57102386-57102408 CTCTGGGAGCAGCCCCCGGTTGG + Exonic
1097225807 12:57476284-57476306 ATGTGGGGGCGGCAGCGGGGAGG - Intronic
1103741310 12:123093637-123093659 CTCTGGGGGCCAGCCCTGGGAGG + Intronic
1104281383 12:127381193-127381215 CTCTGGGAGCCTCCGCGGGGAGG + Intergenic
1105068801 12:133221319-133221341 CTCTGGGGATGGCCGCTGGGGGG + Exonic
1105631706 13:22175976-22175998 CTCTGGGGGCAGCCTCCAGGGGG + Intergenic
1106018094 13:25888071-25888093 CTCTGGGGGTGGGGCGGGGGGGG - Intronic
1106506791 13:30377279-30377301 CTCTGGGGGCGGGACCTGGTAGG + Intergenic
1110219672 13:73059554-73059576 CTCTGGAGGCAGCCGCGGGCCGG - Exonic
1110833129 13:80054260-80054282 CTCTGGGGGCTGACCCAGGAGGG + Intergenic
1110860565 13:80341214-80341236 GTCTGGGGCCCGCCCGGGGGGGG + Intergenic
1112091879 13:96091082-96091104 CCCTCGGGGGGCCCCCGGGGCGG - Exonic
1113009464 13:105747303-105747325 CACTGGGGCCTGTCCCGGGGTGG + Intergenic
1113312045 13:109141011-109141033 CGCGGGGGGCGGCCCGGGCGGGG - Exonic
1113493615 13:110712386-110712408 CTCTCGGGGCCACCCCGGAGGGG + Intronic
1113576142 13:111396508-111396530 CTGTGGGGGCGGAGGCGGGGTGG + Intergenic
1113768899 13:112896272-112896294 CTCAGGAGGAGGCCTCGGGGGGG - Intronic
1114269221 14:21091016-21091038 CTCCGGGGGTGGCCCGGGGCCGG + Exonic
1114517217 14:23307851-23307873 CTGTGGAGCTGGCCCCGGGGAGG + Exonic
1117424614 14:55580806-55580828 CTCCGGCGGCGTCCCCGGGCCGG + Intronic
1117659477 14:57988518-57988540 CTCTAGGGGTGGGCCCTGGGCGG + Intergenic
1119281732 14:73414706-73414728 TTCTGGGGGCGGGTGCGGGGGGG + Intronic
1119286423 14:73458444-73458466 ATCTGGGGGCCGTCGCGGGGCGG - Intronic
1119418652 14:74493338-74493360 CTGTCGGGGCGGGCCCGGGGAGG + Exonic
1119984866 14:79126330-79126352 CTCTGGGGACGGTCGTGGGGTGG - Intronic
1122713222 14:103676154-103676176 CTCTCGGGCCGGCCACGGAGGGG - Intronic
1122784716 14:104158387-104158409 CATTGGGGGCTGCCCGGGGGAGG + Intronic
1123040977 14:105490159-105490181 CTGGGGGGGGGGCCCCGAGGCGG + Intronic
1123050751 14:105540861-105540883 TTGTGGTGGAGGCCCCGGGGAGG + Intergenic
1124453615 15:29821781-29821803 CACTGGGGGCGGCCGGGGAGGGG - Intronic
1124641242 15:31397859-31397881 CTTTGGGGGTGGCGGCGGGGGGG + Intronic
1125674172 15:41493832-41493854 GGCTGGAGACGGCCCCGGGGCGG - Intronic
1128742810 15:70095743-70095765 TAATGGGGGCGCCCCCGGGGGGG - Intronic
1129708067 15:77805954-77805976 CTCTGAGGTCAGCCCCGGGTGGG - Intronic
1129933622 15:79431951-79431973 CCGAGGGGGCGGTCCCGGGGAGG - Intergenic
1130531129 15:84748535-84748557 CTCCGGGGGCGGAGCGGGGGCGG - Intergenic
1131372016 15:91890470-91890492 CTCTGGGTGAGGCCACTGGGAGG - Intronic
1131822382 15:96286052-96286074 TGCTGGGGGCGGGTCCGGGGAGG + Intergenic
1132178441 15:99733455-99733477 CCCTGGGGGCGGGACTGGGGAGG + Intronic
1132320082 15:100919329-100919351 GTCTGGGCCCGGCCCCGGCGCGG + Exonic
1132338628 15:101064465-101064487 CCCTGGGAGGTGCCCCGGGGCGG + Intronic
1132519865 16:382029-382051 GTCGGGGGGCGGGACCGGGGGGG + Intronic
1132566864 16:627569-627591 TTCTGGGGGGGGCTCTGGGGTGG - Exonic
1132658201 16:1049970-1049992 CCCTGGAGGCAGCCCTGGGGAGG + Intergenic
1132766426 16:1536688-1536710 CTCTGGGCGCGTCCCCGTGTTGG - Intronic
1132810130 16:1793384-1793406 CGCTGGCGGCGGCACAGGGGAGG - Intronic
1132853051 16:2033400-2033422 CTCTGGGGTGGGCTCCGTGGAGG - Intronic
1132889442 16:2196630-2196652 GGCGGGGGGCGGCCCGGGGGCGG + Intergenic
1132978266 16:2721142-2721164 CTCTGGGCGCGGCGCCGCGGCGG + Intergenic
1133101870 16:3484883-3484905 CTCTGCGGGCGGCCGAAGGGTGG - Exonic
1133350623 16:5098231-5098253 CTCAGGAGGCGGGGCCGGGGCGG + Intergenic
1133350669 16:5098382-5098404 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
1134050002 16:11130784-11130806 CTCTGGCTGCTGCCTCGGGGTGG + Intronic
1134290881 16:12902199-12902221 CTCCGGAGGCGGCCCCGGAGCGG - Exonic
1134509283 16:14833723-14833745 CTCTGGCGGCGGCGGTGGGGCGG + Exonic
1134974854 16:18562147-18562169 CTCTGGCGGCGGCGGTGGGGCGG - Intronic
1136189390 16:28606658-28606680 CTGTGGGGGCTGCCCAGGGAGGG + Intronic
1136518960 16:30784320-30784342 CTCTGGGGGACACCCGGGGGAGG - Intronic
1136617011 16:31404385-31404407 CCCTGGGAGCAGCCCTGGGGTGG + Intronic
1137578654 16:49620645-49620667 CCCTTGGGGGAGCCCCGGGGAGG - Intronic
1138751730 16:59430649-59430671 CTCTGGGGCCTGCCAAGGGGTGG + Intergenic
1139484605 16:67248659-67248681 CGCTGCGGGCTGCCCCAGGGGGG + Intronic
1139528571 16:67530533-67530555 CGGTCGGGGCGGCCCCGGGGTGG + Intronic
1139701741 16:68711878-68711900 CTCTGGGTGCAGCCCAGGGATGG + Intronic
1141083833 16:81077241-81077263 CGCTGGGGGCGGGACCGCGGCGG + Exonic
1141531238 16:84648467-84648489 CAATGGCGGCGGCCGCGGGGAGG - Intergenic
1141620504 16:85234740-85234762 CTGCGGGGGCGGAGCCGGGGCGG - Intergenic
1141638622 16:85328815-85328837 CACCGCGGGAGGCCCCGGGGCGG - Intergenic
1141830963 16:86509917-86509939 TTCTGCTGGCGGCCGCGGGGCGG + Intergenic
1142130001 16:88428086-88428108 CTCTGGGGGGGCCCCGGGGCTGG - Exonic
1142136217 16:88453154-88453176 CGCTGGGGGCGGAGCCGGAGAGG + Intergenic
1142143459 16:88482907-88482929 CTCTGGGGTCGGCCCTGAGCAGG - Intronic
1142293018 16:89201349-89201371 CGCGGGGCGCGGGCCCGGGGCGG + Intronic
1142367560 16:89657988-89658010 CCCTGGGCGCGGGCCCAGGGCGG + Intronic
1142682512 17:1558773-1558795 CTCTGGGGGGGGGGGCGGGGGGG - Intronic
1142811568 17:2397901-2397923 CTTTGGGGGCAGCCTCTGGGTGG - Intronic
1142812559 17:2402017-2402039 CTCTGGGGCCGGGGCCAGGGCGG + Intergenic
1142836859 17:2593859-2593881 CGCTGGGCCCGGGCCCGGGGAGG - Exonic
1142957464 17:3531527-3531549 CGCTGTGGCCGGCCCGGGGGAGG - Intronic
1143171637 17:4933869-4933891 CTCTGAGGTGGGCTCCGGGGTGG - Exonic
1143499224 17:7329261-7329283 CTCTGGGGGAGGCCCTGGACCGG - Exonic
1144806729 17:17972606-17972628 CTTTGGGGGCGGGCCAGGGGAGG - Intergenic
1144907770 17:18650347-18650369 CTCTGGGAGCGCCCCGGGCGGGG - Intronic
1145041230 17:19579758-19579780 CTCTGGGGGAGGGCACCGGGAGG - Intergenic
1146948540 17:36890394-36890416 TTCTGGGGGTGTCCCTGGGGTGG - Intergenic
1147685941 17:42287026-42287048 CTCTGCAGGGGGCCCCAGGGAGG - Intergenic
1148268239 17:46243605-46243627 CTCTGCGGGCGGCGGCGGCGCGG + Intergenic
1148491282 17:48025332-48025354 CTCCAGGGGCGGGGCCGGGGTGG + Intergenic
1148929955 17:51120294-51120316 CTCCGGGGGCGGCCGGGGCGGGG - Intronic
1149614674 17:57988055-57988077 TACTGGGGGCCCCCCCGGGGGGG - Intronic
1150284592 17:63947778-63947800 CTCTGGGGGTGGCCTCGGGCAGG + Intronic
1151555255 17:74843275-74843297 CTCTGGGGGCGGGTCGGGGGTGG + Exonic
1151564940 17:74892794-74892816 CTCTGGGGGCTGCCACTGGCCGG + Intronic
1151570540 17:74923416-74923438 CACAGTGCGCGGCCCCGGGGTGG - Intergenic
1151727421 17:75892961-75892983 CTCTGGAGGCTGGCCTGGGGTGG - Intronic
1152571154 17:81121817-81121839 CTCTGCGGGCGGCCACGCTGAGG - Exonic
1152588334 17:81199027-81199049 CTCTGGAGGCACCCCCGGGAAGG + Intronic
1152631817 17:81413939-81413961 GGCTGGGGGAGCCCCCGGGGTGG - Intronic
1152637549 17:81436304-81436326 CTCTGGGGGCAGCTGCGGGTGGG - Intronic
1152693517 17:81732759-81732781 CTCTGGAGGCTTCCCAGGGGAGG - Intergenic
1152762506 17:82116384-82116406 CCCAGGGAGCGGCCCAGGGGCGG + Intronic
1152924151 17:83079874-83079896 CGGCGGGGGCGGGCCCGGGGCGG - Exonic
1152945942 17:83197360-83197382 GTCTGGGGGCCTCCCCGGGCGGG - Intergenic
1153040913 18:812333-812355 GTCAGGGGGCGGGGCCGGGGGGG - Intronic
1154156365 18:11947587-11947609 ATCTGGGGGCGGCCTCCCGGGGG - Intergenic
1154416343 18:14177907-14177929 CACTGCCGGCGGCGCCGGGGTGG + Intergenic
1157384091 18:47247582-47247604 CTGCGGGGGCTGCCCCGGCGGGG + Intronic
1157582419 18:48781300-48781322 CTCTGGGGGCGGCGGCTGGGAGG + Intronic
1157606220 18:48927481-48927503 CTCTGGGGTTGGCACAGGGGCGG - Intronic
1157812348 18:50706395-50706417 CTGTGGGGGCGGAGGCGGGGGGG - Intronic
1160518850 18:79493221-79493243 CGCTGGGGGCGGACTCGCGGTGG + Intronic
1160763480 19:797272-797294 CTCTGGGTCCCGCCCCCGGGCGG + Exonic
1160788312 19:912077-912099 GTGGGGGCGCGGCCCCGGGGAGG + Intronic
1160788384 19:912225-912247 GTGGGGGCGCGGCCCCGGGGAGG + Intronic
1160808674 19:1003512-1003534 CCCTGGTGGCAGCCCCGCGGTGG - Exonic
1160831282 19:1105902-1105924 CTCGGGGGGCGGTTGCGGGGAGG + Intronic
1160863993 19:1249298-1249320 CTAGGGCCGCGGCCCCGGGGAGG - Intronic
1161080352 19:2307436-2307458 CTCTGGGGCCTGGCCAGGGGAGG - Intronic
1161086997 19:2339963-2339985 CTCGGTGCGCGGCCCCGGGCGGG + Exonic
1161175806 19:2841662-2841684 CGCGGGGGGCGGCCCCGGCGAGG + Intronic
1161243295 19:3234907-3234929 CTCTGGTGGCTGCTGCGGGGAGG - Intronic
1161250161 19:3276031-3276053 CTCTGGGGGCGGGGCCTGTGGGG + Intronic
1161314919 19:3613301-3613323 CTCGGAGGGCGGCCCCGCGGAGG - Exonic
1161400358 19:4064526-4064548 GTCTGGGAGAGGTCCCGGGGAGG - Intronic
1161439113 19:4280336-4280358 CCTTCTGGGCGGCCCCGGGGAGG + Exonic
1161484065 19:4525302-4525324 CTCTGGTGGCTGCTGCGGGGAGG + Intronic
1161494997 19:4581671-4581693 CGCTGGCGTCGGCTCCGGGGGGG + Intergenic
1161968403 19:7561606-7561628 GGCTGGGGGTGGCCCCGTGGGGG + Exonic
1162410452 19:10502497-10502519 CTCTTGGGGTGGCCCGGGAGCGG - Intronic
1162562064 19:11422664-11422686 CTCTGGGGAGGGCGGCGGGGCGG - Intronic
1162582556 19:11539869-11539891 CTCTGGGGCCGGCGCTGGGGGGG - Intronic
1162873066 19:13600329-13600351 CTCTGTGGCCGGCACCTGGGAGG - Intronic
1165138797 19:33687128-33687150 CTTTGGGGCTGGCCCCGGTGGGG + Intronic
1165350027 19:35270065-35270087 CTCTTGGGGAGCCCCGGGGGTGG + Intronic
1165445968 19:35856856-35856878 CCCGGGGGGCGGACCCGGGCGGG + Intronic
1165925020 19:39321128-39321150 GTCTGGGGGGGTCTCCGGGGAGG - Intergenic
1165994990 19:39837681-39837703 GTCTGGGGGTGGCCCCGGTGGGG - Intronic
1166682568 19:44777936-44777958 CTCTGGCGGTGGCCCCGTGGGGG + Exonic
1167056141 19:47112543-47112565 CTCTGATGGCGGCGGCGGGGGGG + Exonic
1167286467 19:48601288-48601310 CACTGGAGGAGGCCCCTGGGGGG - Exonic
1167358508 19:49017929-49017951 CCCTGGGGGCGGGTCTGGGGTGG + Intergenic
1167463857 19:49640049-49640071 GGGCGGGGGCGGCCCCGGGGCGG - Exonic
1167507380 19:49878031-49878053 CTCAGGGGGCGGGGCCGGGAGGG - Intronic
1168062094 19:53898767-53898789 CTCAGGGGGCGTGGCCGGGGGGG + Intronic
925061894 2:897784-897806 CACTGGGGGGGGGCCCGGGGTGG + Intergenic
925927285 2:8679286-8679308 CTCTAGGGCAGGCCCCGCGGCGG - Exonic
927679836 2:25132065-25132087 CACCGGGGGCGGCCCGGGGATGG + Intronic
928077813 2:28281166-28281188 CGGTGGGGGCAGCCCAGGGGAGG - Intronic
932955354 2:76345309-76345331 CTCTGGGGACTGTCCTGGGGTGG - Intergenic
934709262 2:96504274-96504296 CTCTGAGGGCTTCCCCGAGGCGG - Intronic
935320210 2:101879707-101879729 CTCTGGGGGCAGTCCCAGGGTGG - Intronic
935692796 2:105745380-105745402 ATCGGGGGCCGGCCCAGGGGCGG + Intronic
936460264 2:112709160-112709182 CTCGGAGGGCGGCTCCTGGGGGG - Intergenic
937237981 2:120442139-120442161 TTATGGGGCCGGCCCCAGGGAGG + Intergenic
938264074 2:129913757-129913779 CTCTGGAGGCAGCCCAGGGGTGG + Intergenic
942449592 2:176100528-176100550 CGTGGGGGGCGGCCCCGGGGAGG + Exonic
942450914 2:176107619-176107641 CAGCGGGGGCGGCCCCGGCGGGG + Exonic
944206664 2:197164429-197164451 CTCTGGGGGCGGCCACACTGTGG + Intronic
945251696 2:207769952-207769974 CTGAGGGGGCGGAGCCGGGGCGG - Intergenic
947537268 2:230948102-230948124 CTGTGGGGGCGGCCAGGGGGTGG - Intronic
947992280 2:234497121-234497143 GTCCGGGGGCGGGTCCGGGGCGG - Intergenic
948237307 2:236400683-236400705 CTCTGGAAGCAGCCCAGGGGAGG - Intronic
948479341 2:238240239-238240261 CCGCGGGGGCGGCACCGGGGCGG + Intronic
948878241 2:240841491-240841513 ATCTGGGGGCAGCCCAGGAGGGG + Intergenic
1168769772 20:407981-408003 GGCTGGGGGCGGGGCCGGGGTGG - Intronic
1171012239 20:21515035-21515057 CTTTGCGGGCGGTCCCGGGGAGG + Intergenic
1171173582 20:23035402-23035424 CTCGGGCGGCGGGCCCAGGGCGG - Exonic
1172011893 20:31850549-31850571 AACTGGGGACGGCCGCGGGGTGG - Intronic
1172099322 20:32475766-32475788 CTGTGAGGGGGGCCCCGGAGGGG - Intronic
1172292459 20:33785912-33785934 TTCTGGGGGGGGCCCGGGGGAGG - Intronic
1172386061 20:34534974-34534996 CTCTGGGGCCGGTCCCTGGGAGG - Intronic
1172650166 20:36497018-36497040 TTTTGGGGGCGGCCTCGGGGTGG - Exonic
1173548137 20:43914781-43914803 CGCGGGGGGCGGGCCGGGGGCGG - Intergenic
1173840437 20:46153357-46153379 CTCTGGGCTGGGCCTCGGGGTGG - Intergenic
1174294367 20:49534458-49534480 CTCTGGGAGCAGCCCTGGGCTGG - Intronic
1175856135 20:62122095-62122117 CTCAGTGGGCGGGACCGGGGAGG - Intergenic
1175874675 20:62223741-62223763 CTCTGGAGGCTGCTCCTGGGTGG - Intergenic
1176042230 20:63071968-63071990 CTTTGGGGGCGGGGGCGGGGAGG - Intergenic
1176178570 20:63739604-63739626 CGGAGGGGGCGGGCCCGGGGCGG + Intronic
1176178662 20:63739846-63739868 CTCAGGACGCGGCCCCGGGCCGG - Exonic
1176550183 21:8217407-8217429 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1176569111 21:8400445-8400467 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1176577025 21:8444677-8444699 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1176856993 21:13981383-13981405 CACTGCCGGCGGCGCCGGGGTGG - Intergenic
1176867604 21:14062840-14062862 CACTGCCGGCGGCGCCGGGGTGG + Intergenic
1179882645 21:44299991-44300013 CGCCGGGGGCGGGCCCGGGGCGG + Intergenic
1180101772 21:45590830-45590852 CTCTGTGGGGGACCCCGGGGAGG + Intergenic
1180559167 22:16601783-16601805 TGCTGCGGGCGGCCCGGGGGAGG + Intergenic
1180614762 22:17120215-17120237 CGCGGGGGGCGGCCTGGGGGCGG - Exonic
1181026823 22:20131726-20131748 CGCTGGGGGCCGCGGCGGGGCGG - Intronic
1181461143 22:23086628-23086650 CTGTGGGCTGGGCCCCGGGGAGG - Intronic
1182532373 22:30969832-30969854 CTCTGGCGGCAGCCCCGGGGTGG + Intergenic
1183441552 22:37825666-37825688 CTCTGGGGGCTGCCCTGCTGGGG - Intergenic
1183517128 22:38273031-38273053 CTCTGGGCTCGCCGCCGGGGAGG + Exonic
1183524904 22:38317192-38317214 CTCGGGGGGCTGCCGCGGGCGGG + Exonic
1183537721 22:38412950-38412972 CTCCGGAGGCGGCCACCGGGCGG + Intergenic
1183577352 22:38700605-38700627 CTCTGGCCGCGGCCCTGCGGAGG + Exonic
1183729079 22:39607075-39607097 CTCTGGGGGTGAGCCAGGGGTGG + Intronic
1183931376 22:41237904-41237926 CCCTCCGCGCGGCCCCGGGGAGG - Exonic
1184240793 22:43210400-43210422 CTCTGGGGGCAGCCCAGGCAGGG - Intronic
1184687767 22:46104233-46104255 CTCTGGGGCCGTGCGCGGGGCGG + Intronic
1184692389 22:46123186-46123208 CTCTGCAGGCGGCCCTGGTGGGG - Intergenic
1184820376 22:46905527-46905549 CCCTGCAGCCGGCCCCGGGGAGG + Intronic
1184981467 22:48098999-48099021 CTCTGGGGAGGGCCCCGGTGGGG - Intergenic
1185315875 22:50178875-50178897 CGCTGGGGGCGGCGCAGCGGAGG + Intronic
1203255078 22_KI270733v1_random:133745-133767 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1203263134 22_KI270733v1_random:178824-178846 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
950004481 3:9682937-9682959 CTCGGGGGGCGGGGGCGGGGGGG - Intronic
950161067 3:10761656-10761678 CACTGAGGGCAGCCTCGGGGGGG - Intergenic
950532995 3:13563840-13563862 TTCTGGAGGCGACCCTGGGGCGG + Intronic
950560550 3:13718997-13719019 CTTTGGGGGAGGGGCCGGGGTGG - Intergenic
953447360 3:42979559-42979581 CGCCGGGGGCGGCCAAGGGGAGG + Exonic
953464356 3:43105910-43105932 CGCTGGGGGCGGCGGCGGGGTGG - Exonic
953705155 3:45225535-45225557 CGCTGGGGGCGGCGGCGGGCCGG + Exonic
953771296 3:45780185-45780207 CTGTGGCGACCGCCCCGGGGTGG + Intronic
954912637 3:54122210-54122232 CTCTGGGGCTGGCCCCGGGCCGG - Intergenic
956678127 3:71754003-71754025 GGCAGGGGACGGCCCCGGGGCGG + Intronic
956813648 3:72888410-72888432 CTCCCGGGCTGGCCCCGGGGAGG - Exonic
957054890 3:75435578-75435600 CTCAGGAGGCGGGGCCGGGGCGG + Intergenic
957054935 3:75435729-75435751 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
958204236 3:90369535-90369557 CTCTGGGGACTGCTCTGGGGTGG - Intergenic
958692151 3:97481688-97481710 CACAGGGGGCGGGGCCGGGGCGG - Intronic
961299903 3:125915945-125915967 CTCAGGAGGCGGGCCCTGGGAGG - Intergenic
961358243 3:126352191-126352213 CTCTGGGGCTTGCCCAGGGGAGG + Exonic
961513547 3:127419269-127419291 CTCTGTGGGGGGCCCAGGTGGGG + Intergenic
961888561 3:130111977-130111999 CTCAGGAGGCGGGGCCGGGGCGG + Intronic
961888607 3:130112128-130112150 CTCAGGAGGCGGGCCCTGGGAGG + Intronic
967864781 3:194181258-194181280 CTCTAGGGGAGGGCCCTGGGAGG - Intergenic
968479249 4:826360-826382 GGCGGGGGGCGGACCCGGGGCGG + Intergenic
968623376 4:1614670-1614692 TCCTGGGGGCAGCCCAGGGGAGG + Intergenic
968651783 4:1763043-1763065 CTCGGGTGGGGGTCCCGGGGTGG + Intergenic
968652928 4:1767221-1767243 CGCTGGGGCCGGGCCAGGGGCGG + Intergenic
968997750 4:3956035-3956057 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
969816627 4:9691966-9691988 CTCAGGAGGCGGGGCCGGGGCGG - Intergenic
971255032 4:25006458-25006480 CTCTGGGGGCTGACACTGGGTGG + Intronic
976629363 4:87220682-87220704 CCGTGGGGGTGGCCTCGGGGAGG - Intronic
977141409 4:93376804-93376826 CACTGGGGCCTTCCCCGGGGTGG + Intronic
979231509 4:118352914-118352936 CCCTGGCGGCGGCCGCGGGTGGG + Exonic
980730043 4:136812540-136812562 CTTGGGGGTCGGGCCCGGGGTGG - Intergenic
985782042 5:1876587-1876609 CTACGGGAGCGGCCCGGGGGCGG - Intergenic
986726544 5:10602189-10602211 CCCTGGGTGAGGCCCCGGGATGG - Intronic
987050853 5:14145049-14145071 TGCTGGTGGCGGCCTCGGGGAGG + Intronic
988796379 5:34656566-34656588 CGCTGGGGACGGCGCCCGGGCGG + Intronic
992889991 5:81195185-81195207 CTCTGGCGCGGGCCCCTGGGTGG - Intronic
996185255 5:120465564-120465586 CTCAGGCGGCGGCTCCGGGCGGG + Intronic
997265170 5:132490987-132491009 CGCTCGGGGCGGGCCCGCGGTGG - Intergenic
997291179 5:132737072-132737094 GTCTGGGGGTGGCCACGGTGGGG - Intronic
997303429 5:132822841-132822863 CCCTGGGGGCCGCGCCGGGCTGG + Exonic
1002054135 5:176589185-176589207 AACTGCGGGCGGCCCCGGGAGGG + Intronic
1002715500 5:181224223-181224245 CTGTGGGGGCTGGCGCGGGGTGG + Exonic
1002784532 6:391692-391714 CTCTGGGGCGGGGCCTGGGGCGG - Intergenic
1002900035 6:1402575-1402597 TCCTGCGGGCGGCCCCGGCGTGG - Intergenic
1003053839 6:2802139-2802161 CTCTGTGGGCAGCCCTGGGATGG - Intergenic
1004722166 6:18277307-18277329 CTCTGAGGGCGCCCGCGGGGCGG + Intergenic
1006517801 6:34554490-34554512 CTCTGAGTGAGGCCCCGTGGGGG - Intronic
1006579265 6:35067246-35067268 CTGTGGGGCTGGCCCGGGGGTGG - Intronic
1007361365 6:41358703-41358725 CTATGGGGGCGGGCGGGGGGTGG - Intergenic
1007387468 6:41529418-41529440 CTCTGAGGGAGTCCCCGGAGGGG - Intergenic
1007558079 6:42783054-42783076 ATCTGCGGGCGGCCGCGGCGAGG + Intronic
1007946220 6:45829481-45829503 CTCTGGGTGCAGCCCCAGGAGGG - Intergenic
1015149527 6:130020869-130020891 TTCTGGCGGTGGCCCCGAGGTGG - Intronic
1018767751 6:166947040-166947062 CTCTGGGGTCAGCCCCGGCTGGG + Intronic
1019428320 7:987565-987587 CTCTGGGGTAGGCCTCGGCGGGG + Intronic
1019542502 7:1557929-1557951 CTCTGGGCCCGGGCCCGGGTGGG - Intronic
1019663873 7:2241859-2241881 CGCCGGGGGCGAGCCCGGGGCGG - Intronic
1020259213 7:6521293-6521315 CTTAGGAGGCAGCCCCGGGGAGG + Intronic
1022710537 7:32845038-32845060 CCCTGGAGGCGGCCCAGGAGAGG + Intergenic
1023243822 7:38178732-38178754 CGGTGGGGTCGGCCCCGGGCTGG + Intronic
1023937271 7:44748883-44748905 GGGTGGCGGCGGCCCCGGGGCGG + Intronic
1024043820 7:45574460-45574482 CGCGGGCGGCGGCGCCGGGGCGG - Intronic
1024472205 7:49775588-49775610 CTCTCGGGACGGCCCGGGGCGGG + Exonic
1027592559 7:80134763-80134785 CTCTGGGAGTGGTCGCGGGGTGG + Intronic
1029110557 7:98211378-98211400 CCCTCGGGGCGGGGCCGGGGCGG - Intergenic
1029743366 7:102503514-102503536 CTCTGGGGGTGGCAGGGGGGTGG + Intronic
1029761355 7:102602675-102602697 CTCTGGGGGTGGCAGGGGGGTGG + Intronic
1030104571 7:105976019-105976041 CCCTGGGGGAGCCCTCGGGGAGG + Intronic
1030176502 7:106660423-106660445 CTCGGGGGGCGGCGGCGGTGGGG + Exonic
1031022651 7:116644859-116644881 CTCTGGGGCAGGCCCAGGGTAGG - Intergenic
1031968395 7:128045275-128045297 TTCTGGGGGCAGCCACTGGGTGG - Intronic
1034347650 7:150397208-150397230 CACTCGGGGCGCCCCCGCGGCGG - Exonic
1035031279 7:155862737-155862759 CTCTGGTGGCTGCACCTGGGAGG + Intergenic
1035295578 7:157865204-157865226 CTGTGGGGGTGGCCCCTGAGGGG + Intronic
1035404258 7:158587835-158587857 CGCCGGGGGCGGGGCCGGGGCGG - Intergenic
1035582484 8:748286-748308 CTCTGGTGGTGGCTCCGTGGGGG + Intergenic
1036379495 8:8227925-8227947 CTCAGGAGGCGGGCCCTGGGAGG - Intergenic
1036850064 8:12194688-12194710 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
1036871428 8:12436961-12436983 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
1037880073 8:22568992-22569014 CCCTGGGGGCAGCCACGGGTGGG - Intronic
1038406215 8:27324918-27324940 CTCTGGGCGGGGCCCCTGGAAGG + Intronic
1039493673 8:37965678-37965700 CTCTGGCCCCGGCCCCGGTGGGG - Exonic
1042902915 8:73746595-73746617 CTCTCGGGGCAGCAGCGGGGAGG - Intronic
1044692898 8:94896266-94896288 CGCTGGCGGCGGCGGCGGGGCGG - Intronic
1045853691 8:106736166-106736188 CTCTGGGGGCGGATGGGGGGGGG - Intronic
1049093931 8:140536785-140536807 ATCTGGGGGCTGCAGCGGGGAGG + Intronic
1049102801 8:140591077-140591099 CTCTGGGTGCAGCCCCGGGTGGG + Intronic
1049564325 8:143330404-143330426 CTGTGGGGGCTGCCCACGGGAGG - Intronic
1049671436 8:143871830-143871852 CTCTCAGGGGGACCCCGGGGAGG - Exonic
1049804955 8:144534519-144534541 CCCTGGGTCAGGCCCCGGGGAGG - Intronic
1049867849 8:144950568-144950590 CTCTGGGGGCTGCCTCCGGTAGG - Intronic
1050388205 9:5111885-5111907 CTCTGGGGACGCCCTCGGGAAGG + Intronic
1052362228 9:27573488-27573510 GCCCGGGGGCGGGCCCGGGGCGG - Intronic
1055454351 9:76459156-76459178 CTCTGGGGGCGGCCCCGGGGCGG + Intronic
1056532237 9:87497958-87497980 GTCTGGGGCCGGCGCCTGGGAGG + Exonic
1056843779 9:90019689-90019711 CTCTGGGGGCGTCGCTGGAGAGG - Intergenic
1057352899 9:94315536-94315558 CAGTTGGGGCGGCCCCGGGCAGG - Intergenic
1057410308 9:94811734-94811756 CTCTGGGGGCTGCACCTGAGTGG - Intronic
1057654848 9:96942055-96942077 CAGTTGGGGCGGCCCCGGGCAGG + Intronic
1059433487 9:114263517-114263539 CTGTGGGAGCGGCCCTGGAGGGG + Intronic
1059455671 9:114398560-114398582 AGCAGGGGGCGGCCCGGGGGGGG + Intergenic
1059769718 9:117414388-117414410 CACTCGGGGCAGCCCCGGGCAGG + Intronic
1060045436 9:120336773-120336795 CCCTGGCTGCGGCCCCAGGGAGG - Intergenic
1060417863 9:123445358-123445380 GCCTGGGGGCAGCCCAGGGGTGG - Intronic
1060539416 9:124419694-124419716 CTCTGGAGGTGGCCCCGCAGAGG + Intergenic
1060856036 9:126915269-126915291 CGCGGGGGGCGGGGCCGGGGGGG + Intronic
1061089938 9:128420820-128420842 CTCTCGGGCCGGCCGAGGGGAGG - Exonic
1062038726 9:134394551-134394573 CTCTGGGGGAGGCCCGGGCAGGG + Intronic
1062213067 9:135374984-135375006 CTCTGTGGCCGCCTCCGGGGTGG + Intergenic
1062227765 9:135463157-135463179 CTCTGGGTGGGGCCCCTGGAAGG - Intergenic
1062381771 9:136290276-136290298 CCCTGGGGGAGGCCCTGGTGAGG - Intronic
1062479037 9:136743038-136743060 GTCTGGGGGTGGTCCCTGGGCGG - Intronic
1062565803 9:137163479-137163501 AGCTGGGGGCGGGGCCGGGGCGG - Intronic
1062619365 9:137412593-137412615 CTCTGGGGGCTGCTCCCGGGGGG - Intronic
1062696578 9:137878855-137878877 CCCTAGGGGCGGCCGCGAGGCGG - Intronic
1203471476 Un_GL000220v1:116882-116904 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1203479297 Un_GL000220v1:160854-160876 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1185747554 X:2584458-2584480 CCCTGGGGGCGGCCGGGAGGAGG + Intergenic
1186554853 X:10547183-10547205 CTCTGGAGGCTGAGCCGGGGAGG + Intronic
1189248000 X:39578467-39578489 CTCTAGGGGTGGCCCCTGGCGGG + Intergenic
1190024665 X:46912540-46912562 CGCGGGGGGCGGCCCCGGCGGGG + Exonic
1192360098 X:70433962-70433984 CTCTTGGGGCGGCCACAAGGTGG - Intergenic
1195618311 X:106930078-106930100 CTCTGTGGGTGGACCCTGGGGGG - Exonic
1197745972 X:129932407-129932429 CGCGGGGCGCGGCCGCGGGGCGG - Intergenic
1198276140 X:135097720-135097742 GGCTGGGGGCGGCCCCGGGAAGG - Intergenic
1199879144 X:151959102-151959124 CTCTGGGAGCTACCCTGGGGAGG + Intronic
1200049830 X:153422901-153422923 ATCTGGGGGCAGGCCTGGGGTGG - Intergenic
1200787545 Y:7273745-7273767 CGCCCGGGGCGCCCCCGGGGTGG - Intergenic