ID: 1055455599

View in Genome Browser
Species Human (GRCh38)
Location 9:76468669-76468691
Sequence ATCTCTCTTTAGCAGAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055455597_1055455599 15 Left 1055455597 9:76468631-76468653 CCAGATACGTAAGAGTGGTTGAG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 1055455599 9:76468669-76468691 ATCTCTCTTTAGCAGAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055455599 Original CRISPR ATCTCTCTTTAGCAGAAAGA TGG Intronic
No off target data available for this crispr